ABCC7 Antibody

What is ABCC7 and what is its primary function in biological systems?

ABCC7, also known as the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR), functions as a cAMP-regulated chloride channel that plays a critical role in regulating chloride ion absorption and elimination across various tissues, including the gastrointestinal tract . It belongs to the ATP-binding cassette (ABC) transporter family, which comprises 48 transmembrane proteins organized into 7 subfamilies (ABCA-ABCG) . ABCC7 specifically serves as an ionic channel that actively participates in epithelial cell ion transport mechanisms, and its proper functioning is essential for maintaining electrolyte balance in secretory and absorptive epithelia .

The significance of ABCC7 is underscored by the fact that mutations in this protein are responsible for cystic fibrosis, a common genetic disorder affecting primarily the lungs and digestive system . Approximately 70% of all cystic fibrosis cases share a specific mutation - the deletion of a phenylalanine at position 508 (delta F508) - which results in abnormal chloride transport and subsequent pathophysiological changes .

How is ABCC7 expression regulated in inflammatory conditions?

ABCC7/CFTR expression demonstrates significant alterations during inflammatory processes, particularly in inflammatory bowel diseases such as ulcerative colitis (UC). Research has shown a marked downregulation of both gene and protein expression of CFTR in patients with active UC compared to those in remission and normal controls without inflammation . This downregulation appears to correlate with increased inflammatory activity, as demonstrated by elevated IL-6 expression in active UC samples .

The mechanistic relationship between ABCC7/CFTR downregulation and inflammation involves several signaling pathways. Studies have demonstrated that decreased CFTR expression leads to increased activity of the transcriptional nuclear factor κB (NF-κB) and enhanced production of proinflammatory cytokines . This finding has been corroborated across multiple cell lines, including human bronchial epithelial cells and colorectal carcinoma cell lines, where CFTR downregulation consistently results in elevated levels of pro-inflammatory mediators such as IL-6, IL-1β, and IL-8 through activation of ERK1/2, MAPK, IκBα, and NF-κB pathways .

What are the common applications for ABCC7 antibodies in research settings?

ABCC7 antibodies serve as essential tools in diverse research applications aimed at investigating CFTR function, expression, and associated pathologies. Primary applications include:

• Western Blot Analysis: ABCC7 antibodies enable protein detection and quantification in tissue samples. This technique has been successfully employed to compare CFTR protein expression levels between patients with active UC, those in remission, and normal controls .

• Immunohistochemistry: ABCC7 antibodies can be used to visualize the distribution and localization of CFTR in tissue sections, providing insights into spatial expression patterns in different physiological and pathological states.

• Inflammatory Disease Research: ABCC7 antibodies are instrumental in studying the role of CFTR in inflammatory conditions, particularly inflammatory bowel diseases, where CFTR expression correlates with clinical outcomes .

• Cystic Fibrosis Research: These antibodies facilitate the detection of normal and mutant forms of CFTR, including the common delta F508 mutation, supporting research into cystic fibrosis pathogenesis and potential therapeutic interventions .

What protocols should be followed when using ABCC7 antibodies for Western blot analysis?

When employing ABCC7 antibodies for Western blot analysis, researchers should adhere to the following optimized protocol based on successful experimental approaches:

• Sample Preparation: Total protein from tissue samples should be extracted using RIPA buffer supplemented with protease inhibitor cocktail. For optimal results, proteins should be quantified using the Bradford assay and stored at -70°C until use .

• Electrophoresis: Separate proteins on a 7.5% SDS-PAGE gel, which provides appropriate resolution for the ABCC7/CFTR protein .

• Transfer and Blocking: Transfer proteins to polyvinylidene difluoride (PVDF) membranes and block with 3% BSA for 60 minutes at room temperature to minimize non-specific binding .

• Primary Antibody Incubation: Dilute ABCC7/CFTR antibodies to a 1:1000 concentration and incubate overnight at 4°C to ensure optimal antigen-antibody binding .

• Detection and Visualization: Following appropriate washing steps and secondary antibody incubation, visualize bands using chemiluminescence detection systems.

• Controls: Include both positive controls (tissues known to express ABCC7) and negative controls (antibody diluent without primary antibody) to validate specificity.

• Reconstitution of Lyophilized Antibodies: For lyophilized antibodies, reconstitute in 100 μL of sterile water and centrifuge to remove any insoluble material prior to use .

How can ABCC7 expression be accurately quantified at the gene level?

Accurate quantification of ABCC7/CFTR gene expression requires careful attention to experimental design and analytical methodologies:

• Primer Design: Use specifically designed forward and reverse primers for ABCC7/CFTR amplification. Validated primer sequences include:

  • ABCC7/CFTR left: ctgactgtttccatcaagggta

  • ABCC7/CFTR right: gcagtcttcttaagagtcagtttgg

• Reference Gene Selection: Employ stable reference genes such as β-actin for normalization purposes to account for variations in RNA input and reverse transcription efficiency .

• Quality Control: Include appropriate positive controls (such as tissues known to express ABCC7/CFTR) and negative controls (no template) in each RT-PCR run.

• Comparative Analysis: When studying inflammatory conditions, consider measuring the expression of inflammatory markers such as IL-6 (primers: left: gatgagtacaaaagtcctgatcca, right: ctgcagccactggttctgt) alongside ABCC7/CFTR to establish correlations between CFTR expression and inflammatory status .

• Data Normalization and Statistical Analysis: Apply appropriate normalization methods and statistical tests to interpret gene expression data accurately, considering factors such as sample heterogeneity and experimental variability.

How does ABCC7/CFTR expression correlate with clinical outcomes in ulcerative colitis?

Research has established significant associations between ABCC7/CFTR expression patterns and clinical manifestations in ulcerative colitis patients:

Statistical analysis of these data reveals that gene expression of ABCC7/CFTR is significantly associated with the clinical course of disease (P = 0.005, OR = 21.7, 95% CI: 3.59–132.0) . Patients with low CFTR expression are more likely to experience persistent or intermittent disease activity compared to those with normal expression levels, suggesting that ABCC7/CFTR could serve as a potential biomarker for predicting disease course and treatment response in UC patients .

Further supporting this clinical correlation, protein expression analysis through Western blot demonstrates reduced CFTR/ABCC7 protein levels in colonic biopsies from patients with active UC compared to those in remission or normal controls (P = 0.046) . These findings indicate that ABCC7/CFTR expression may have prognostic value in determining which patients are at higher risk for persistent inflammatory activity.

What is the relationship between ABCC7/CFTR dysfunction and bacterial infections?

The relationship between ABCC7/CFTR function and susceptibility to bacterial infections represents a fascinating aspect of CFTR biology with significant clinical implications:

CFTR has been identified as a cellular receptor utilized by certain pathogens, most notably Salmonella typhi, to gain entry into intestinal epithelial cells . Research using murine models has demonstrated that delta F508 mutation carriers (both heterozygotes and homozygotes) exhibit substantial reductions in S. typhi intestinal submucosal uptake, with heterozygotes showing an 86% reduction and homozygotes a complete (100%) reduction .

This observation provides a compelling explanation for the evolutionary persistence of CFTR mutations despite their association with the lethal condition of cystic fibrosis. The heterozygote advantage conferred by reduced susceptibility to typhoid fever may have maintained these mutations in populations historically exposed to S. typhi . This represents a classic example of balancing selection, where the detrimental effects of homozygous mutations are offset by the protective effects in heterozygotes.

For researchers investigating host-pathogen interactions, ABCC7 antibodies provide valuable tools for elucidating the molecular mechanisms underlying these interactions, potentially informing novel therapeutic strategies targeting infection pathways that depend on CFTR-mediated entry.

What challenges exist in detecting mutant forms of ABCC7/CFTR using antibodies?

Detection of mutant forms of ABCC7/CFTR, particularly the common delta F508 variant, presents several technical challenges that researchers should consider when designing experiments:

• Protein Misfolding and Degradation: The delta F508 mutation causes protein misfolding, leading to enhanced endoplasmic reticulum-associated degradation (ERAD) and reduced cell surface expression. This results in significantly lower protein levels available for detection, necessitating highly sensitive antibodies and detection methods .

• Epitope Accessibility: Structural alterations in mutant CFTR proteins may affect epitope accessibility, potentially reducing antibody binding efficiency. Researchers should select antibodies raised against epitopes that remain accessible in the mutant protein conformations.

• Cross-Reactivity Concerns: Ensuring antibody specificity for distinguishing between wild-type and mutant CFTR requires rigorous validation, particularly in heterozygous samples where both forms are present.

• Subcellular Localization Differences: While wild-type CFTR predominantly localizes to the plasma membrane, mutant forms may accumulate in intracellular compartments, necessitating different sample preparation protocols for effective detection.

When working with patient samples potentially containing CFTR mutations, researchers should consider employing multiple detection methods and using antibodies specifically validated for detecting mutant forms of the protein.

How can researchers optimize experimental conditions when investigating ABCC7/CFTR in inflammatory models?

When investigating ABCC7/CFTR in inflammatory models, researchers should implement the following optimization strategies:

• Comprehensive Inflammation Assessment: Measure multiple inflammatory markers alongside ABCC7/CFTR expression. Research has shown significant correlations between CFTR downregulation and elevated IL-6 expression in active UC, making IL-6 a valuable marker for confirming inflammatory status .

• Timing Considerations: Account for the temporal dynamics of inflammation when designing experiments. CFTR expression changes may precede, coincide with, or follow alterations in inflammatory markers, necessitating time-course studies for comprehensive analysis.

• Cell-Type Specific Analysis: Consider that CFTR expression and its response to inflammatory stimuli may vary between different cell types within the same tissue. When possible, employ cell-type specific isolation techniques or single-cell analysis approaches.

• Pathway Inhibition Studies: To elucidate the mechanistic relationship between CFTR expression and inflammation, incorporate specific inhibitors targeting key signaling pathways such as NF-κB, ERK1/2, and MAPK, which have been implicated in mediating the effects of CFTR downregulation on inflammatory responses .

• Model Selection: Choose appropriate experimental models based on research objectives. Cell lines (such as CACO2 and HT29), animal models (CFTR knockout mice), and patient-derived samples each offer distinct advantages and limitations for investigating CFTR in inflammatory contexts .

What criteria should guide the selection of ABCC7/CFTR antibodies for specific research applications?

When selecting ABCC7/CFTR antibodies for research, consider these critical parameters to ensure optimal experimental outcomes:

• Target Species Homology: Verify the sequence homology between the immunogen used to generate the antibody and your target species. For example, some commercially available antibodies are generated against peptides that share 93-95% identity between human and rat CFTR sequences .

• Immunogen Location: Consider which region of the CFTR protein the antibody targets. Antibodies targeting different domains may yield varying results depending on protein conformation and experimental conditions. For instance, some antibodies are raised against recombinant fragment proteins within specific amino acid ranges (e.g., aa 400-750) .

• Validated Applications: Select antibodies specifically validated for your intended application. Some antibodies are validated for Western blot but may not perform optimally in immunohistochemistry or other applications .

• Published Citations: Prioritize antibodies with demonstrated utility in peer-reviewed publications, particularly in experimental contexts similar to your research focus .

• Clonality Considerations: Choose between polyclonal and monoclonal antibodies based on your specific research needs. Polyclonal antibodies offer broader epitope recognition but potentially lower specificity, while monoclonal antibodies provide high specificity for a single epitope .

What controls should be implemented when validating ABCC7 antibodies for experimental use?

Rigorous validation of ABCC7 antibodies requires implementation of appropriate controls to ensure reliable and reproducible results:

• Positive Tissue Controls: Include tissues known to express high levels of CFTR, such as lung or intestinal epithelium, to confirm antibody functionality.

• Negative Controls: Employ tissues from CFTR knockout models or those known to express minimal CFTR to assess non-specific binding.

• Peptide Competition Assays: Pre-incubate the antibody with its specific immunogenic peptide prior to application to verify binding specificity. Signal elimination in this condition confirms antibody specificity.

• Secondary Antibody Controls: Include samples treated only with secondary antibody to identify potential non-specific binding of the detection system.

• Cross-Reactivity Assessment: Test the antibody against related proteins, particularly other ABC transporters, to ensure it does not recognize unintended targets.

• Method-Specific Controls: Implement technique-specific controls, such as loading controls for Western blot (e.g., β-actin) or isotype controls for immunofluorescence studies .

• Dilution Series: Perform antibody titration experiments to determine optimal concentration for maximum signal-to-noise ratio in your specific experimental system.