ABHD4 Antibody

What is ABHD4 and why is it important in research?

ABHD4 is a hydrolase enzyme involved in phospholipid metabolism with both hydrolase and lysophospholipase activities. Research significance includes:

• Functions as a major regulator of mammalian phospholipid metabolism

• Critical role in developmental anoikis (a form of programmed cell death) in embryonic brain development

• Involvement in endogenous cannabinoid biosynthesis

• Regulatory functions in adipocyte differentiation

The protein is highly expressed in radial glial progenitor cells (RGPCs) during brain development but expression decreases in more committed neuronal cell populations . The temporal expression pattern of ABHD4 appears tightly controlled during development.

Which applications are most common for ABHD4 antibodies?

ABHD4 antibodies are validated for multiple research applications with varying effectiveness:

Most commercially available antibodies show reactivity with human and mouse ABHD4, with some also detecting rat orthologs .

What is the typical molecular weight observed for ABHD4 in Western blotting?

The ABHD4 protein has:

• Calculated molecular weight: 39 kDa (342 amino acids)

• Observed molecular weight: Approximately 39 kDa in most cell lines and tissue samples

Positive Western blot detection has been documented in various cell lines including A549, HepG2, LNCap, and SiHa cells, as well as in mouse testis tissue .

How can I optimize ABHD4 antibody selection for studying developmental anoikis in neurogenesis?

When studying ABHD4's role in developmental anoikis during neurogenesis, consider these methodological approaches:

• Antibody epitope selection: Choose antibodies targeting conserved regions to study evolutionary aspects or specific domains for functional studies

• Validation in knockout models: Validate antibody specificity using ABHD4 knockout tissues (as demonstrated in embryonic cortical samples)

• Combined methodologies: Implement a multi-method approach:

  • Use in situ hybridization to detect Abhd4 mRNA expression patterns

  • Combine with immunostaining for RGPC markers (PAX6, GLAST1) and differentiated neuron markers (TBR1, TBR2)

  • Apply high-resolution visualization techniques for plasma membrane examination

• Temporal expression analysis: Since ABHD4 expression is developmentally regulated, use stage-specific examination with markers for mitotic cells (PHH3) to track expression during cell division

This approach is particularly important as ABHD4's anoikis-mediating function appears specific to delaminated cells, requiring precise spatial and temporal resolution .

What considerations should be made when designing CRISPR knockout experiments to study ABHD4 function?

Based on successful ABHD4 knockout strategies:

• Guide RNA design:

  • Target early exons (e.g., exon 3) to ensure complete functional disruption

  • Example successful guide sequence: TTATGTATCCCTCCCAAACC

• Validation strategies:

  • Confirm editing through Sanger sequencing

  • Verify frameshift mutations that cause premature termination

  • Example verification: Addition of nucleotide (T) during non-homologous end joining repair

• Phenotypic confirmation:

  • For adipocyte studies: Compare wild-type and knockout cell differentiation rates using Oil Red O staining

  • For neurogenesis studies: Examine effects on delamination, migration, and apoptotic markers

• Consider compensatory mechanisms:

  • Despite high ABHD4 expression in certain tissues, knockout models may show minimal phenotypes due to compensation

  • Example: ABHD4 knockout did not affect NAE production in adipose tissue, possibly due to compensation from other NAPE and NAE metabolic enzymes

How should I approach co-localization studies of ABHD4 with developmental markers?

For effective co-localization studies:

• Multi-color in situ hybridization technique:

  • Combine ABHD4 antibody staining with in situ hybridization for Abhd4 mRNA

  • Use additional markers such as Glast1 (RGPC marker), PHH3 (mitotic marker), or TBR2 (intermediate progenitor marker)

• Quantitative analysis methods:

  • Apply correlation analysis between Abhd4 mRNA levels and marker expression

  • Use distribution analysis for mitotic cells (Gaussian distribution analysis)

• High-resolution imaging protocols:

  • Implement STORM microscopy for nanoarchitecture analysis of radial glial processes

  • Use in utero electroporation for single-cell resolution

• Controls and validations:

  • Include appropriate negative controls (knockout tissues)

  • Use enzymatically inactive ABHD4 as a functional control

Why might there be discrepancies between ABHD4 mRNA expression and protein detection in tissue samples?

Discrepancies between mRNA and protein detection could result from:

• Post-transcriptional regulation:

  • ABHD4 expression is tightly regulated during development

  • Rapid downregulation occurs in fate-committed daughter cells after delamination

• Technical considerations:

  • mRNA detection sensitivity: RNA in situ hybridization may detect lower expression levels than antibody-based methods

  • Antibody specificity: Ensure antibodies are validated against knockout controls

• Subcellular localization changes:

  • ABHD4 may undergo redistribution during developmental processes

  • Cell-specific expression patterns may be diluted in whole-tissue lysates

• Resolution of detection methods:

  • Single-cell resolution methods (e.g., RNAscope) may reveal expression patterns not apparent in bulk tissue analysis

How can conflicting data about ABHD4's role in adipocyte development be reconciled?

Reconciling seemingly contradictory findings:

What strategies should be employed for studying ABHD4's enzymatic activity rather than just protein presence?

To investigate ABHD4's enzymatic functions:

• Activity-based protein profiling:

  • Use chemical probes specific for serine hydrolase activity

  • Compare wild-type ABHD4 with enzymatically inactive mutants (modify catalytic residues)

• Substrate specificity analysis:

  • Examine ABHD4's role in phospholipid metabolism through targeted lipidomics

  • Compare NAE levels between wild-type and knockout samples

• Functional rescue experiments:

  • Design experiments with wild-type ABHD4 and catalytically inactive mutants

  • Example: ABHD4's inactive form failed to trigger apoptosis, indicating enzymatic activity is crucial for its function

• Time-resolved activity measurements:

  • Track activity changes during developmental processes or differentiation

  • Correlate with phenotypic outcomes and molecular pathway activation

How can ABHD4 antibodies be effectively used in studying neurodevelopmental disorders?

Application strategies in neurodevelopmental research:

• Spatiotemporal expression mapping:

  • Track ABHD4 expression in normal vs. pathological brain development

  • Focus on radial glial progenitor cells (RGPCs) where ABHD4 is highly expressed

• Mechanistic studies:

  • Investigate ABHD4's role in anoikis as a quality control mechanism

  • ABHD4-mediated developmental anoikis protects embryonic brains from consequences of sporadic delamination errors and teratogenic damage

• Genetic correlation studies:

  • Examine ABHD4 expression in models of known neurodevelopmental disorders

  • Correlate with markers of neuronal migration defects (since ABHD4 activity is non-permissive for radial migration)

• Therapeutic target exploration:

  • Modulation of ABHD4 activity might influence developmental outcomes

  • Study how ABHD4 interacts with pro-survival mechanisms during neuronal development

What is the optimal protocol for investigating ABHD4 in adipocyte differentiation studies?

For robust adipocyte differentiation research:

• Experimental design:

  • Use both genetic approaches (CRISPR knockout) and pharmacological inhibition

  • Include appropriate controls (wild-type cells) at multiple timepoints (Day 3, 6, 9)

• Differentiation assessment:

  • Quantify TAG content biochemically

  • Visualize lipid accumulation via Oil Red O staining

  • Monitor morphological changes during differentiation

• Molecular analyses:

  • Track adipogenic marker expression (e.g., fatty acid synthase, acetyl-CoA carboxylase)

  • Examine enzymes involved in fatty acid esterification (GPAT, AGPAT, DGAT)

• Comparative analysis:

  • Examine differences in differentiation rate rather than just endpoint measurements

  • ABHD4 KO cells showed 10-fold higher TAG content at Day 3, 5-fold higher at Day 6, and 2-fold higher at Day 9 compared to wild-type cells

What emerging techniques might enhance ABHD4 antibody applications in spatial transcriptomics?

Future methodological directions include:

• Integration with single-cell technologies:

  • Combine antibody-based detection with single-cell RNA sequencing

  • Apply spatial transcriptomics to map ABHD4 expression in tissue context

• Advanced imaging approaches:

  • Implement super-resolution microscopy (STORM) for subcellular localization

  • Develop multiplexed imaging to simultaneously track multiple proteins in the ABHD4 pathway

• In vivo live imaging:

  • Generate fluorescently tagged ABHD4 constructs for real-time tracking

  • Study dynamic expression changes during developmental processes

• Proximity labeling approaches:

  • Apply BioID or APEX2 techniques to identify ABHD4 interaction partners

  • Map the molecular network in different cellular contexts

How might comparative studies of ABHD4 across species inform our understanding of its evolutionary conservation?

Evolutionary perspectives should consider:

• Cross-species antibody validation:

  • Test reactivity across human, mouse, rat, and other model organisms

  • Compare epitope conservation in target regions

• Functional conservation analysis:

  • Examine whether ABHD4's role in developmental anoikis is conserved

  • Compare expression patterns in embryonic cortical samples across species and in cerebral organoids

• Structural biology approaches:

  • Use antibodies to purify ABHD4 for structural studies

  • Compare enzyme kinetics and substrate preferences across species

• Developmental timing differences:

  • Investigate how ABHD4 expression correlates with species-specific neurodevelopmental timelines

  • Study whether compensatory mechanisms for ABHD4 loss vary across species