CYB561A Antibody

What is CYB561A3 and what is its biological function?

CYB561A3 (also known as CYBASC3, PSEC0259, Lysosomal membrane ascorbate-dependent ferrireductase CYB561A3, Cytochrome b ascorbate-dependent protein 3, or Lysosomal cytochrome b/LCytb) is a transmembrane reductase protein that plays a crucial role in cellular iron homeostasis. It functions by using ascorbate as an electron donor in the cytoplasm and transfers electrons across membranes to reduce iron cations Fe(3+) into Fe(2+) in the lumen of late endosomes and lysosomes. This reduction process is essential for the subsequent extrusion of iron from these compartments to the cytoplasm via divalent metal-specific transporters . The protein is therefore primarily involved in endosomal and lysosomal cellular iron homeostasis mechanisms.

What antibody formats are available for CYB561A3 research?

For CYB561A3 research, multiple antibody formats are available including:

• Polyclonal antibodies: Such as the rabbit polyclonal antibody ab185304, which targets human CYB561A3 protein regions from amino acid position 200 to the C-terminus .

• ELISA-based detection kits: Sandwich enzyme immunoassay formats are available for quantitative measurement of CYB561 in various sample types including human serum, plasma, cell culture supernatants, and tissue homogenates .

Selection of the appropriate antibody format should be based on the specific application requirements and experimental design goals.

Which experimental techniques can be used with CYB561A3 antibodies?

CYB561A3 antibodies have been validated for multiple experimental techniques:

• Western Blotting (WB): Rabbit polyclonal antibodies against CYB561A3 have been validated for WB applications, typically used at concentrations around 0.4 μg/mL. This technique allows detection of CYB561A3 protein in cell lysates, providing information about protein expression levels .

• Immunohistochemistry with paraffin-embedded sections (IHC-P): CYB561A3 antibodies can be used for tissue localization studies. Protocols typically involve antigen retrieval using citrate buffer, followed by antibody application at 1:100 dilution and overnight incubation at 4°C .

• ELISA: Quantitative measurement of CYB561 levels can be performed using sandwich ELISA techniques with a detection range of 31.25-2000 pg/mL and minimum detectable dose typically less than 15.6 pg/mL .

• qRT-PCR: While not directly using the antibody, this complementary technique allows researchers to measure CYB561 mRNA expression levels using specific primers (forward: TATAGCGCATTTGAGCCCGAG; reverse: CCGGGTCAAGATGTAGAGCAC) .

How should I optimize protein extraction protocols for CYB561A3 detection by Western blot?

For optimal CYB561A3 detection by Western blot, consider these methodological recommendations:

• Cell lysis: Collect cells and lyse on ice for 30 minutes using a lysis buffer containing 20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton x-100, and protease inhibitors .

• Protein separation: After centrifugation at 12,000 rpm for 10 minutes at 4°C, collect the supernatant and determine total protein concentration using a bicinchoninic acid protein assay kit.

• Blocking conditions: After transfer to nitrocellulose membranes, block with 5% skim milk diluted in 1× PBS for 2 hours at room temperature.

• Antibody dilution: Incubate membranes with primary CYB561A3 antibody at 1:1000 dilution overnight at 4°C. After washing with PBS, apply appropriate secondary antibody for 40 minutes at room temperature.

• Detection: Visualize proteins using enhanced chemiluminescence (ECL) after a 5-minute incubation at room temperature .

Including appropriate positive controls and reference standards is crucial for accurate interpretation of results.

What is the significance of CYB561 in breast cancer research?

Recent studies have established CYB561 as a potential therapeutic target in breast cancer research:

• Prognostic significance: Elevated CYB561 expression has been associated with poor prognosis in breast cancer patients, particularly in HER2-positive breast cancers .

• Functional role: Knockdown of CYB561 has been shown to inhibit proliferation, migration, and invasive abilities of breast cancer cells in vitro. Similarly, CYB561 knockdown inhibited tumor formation in vivo .

• Tumor microenvironment: CYB561 expression correlates with macrophage M2 polarization in the breast cancer microenvironment. Specifically, CYB561 positively correlates with CD163 (an M2 macrophage marker) and negatively correlates with CD8+ T cells .

• Molecular mechanisms: Research suggests that CYB561 may upregulate macroH2A (H2AFY) expression in HER2-positive breast cancer cells by inhibiting H2AFY ubiquitination . CYB561 has also been observed to modulate downstream tropomyosin 1 expression and regulate NF-κB expression .

These findings highlight the potential of CYB561-targeted therapies for breast cancer treatment.

How can immunohistochemistry protocols be optimized for CYB561A3 detection in clinical samples?

For optimized immunohistochemical detection of CYB561A3 in clinical samples, consider the following methodological approach:

• Sample preparation: Section paraffin-embedded tissue samples into 4-μm-thick slices.

• Pretreatment: Process sections through baking, dewaxing, and dehydration steps.

• Antigen retrieval: Eliminate endogenous peroxidase activity using 3% H2O2 solution followed by antigen retrieval with 0.01 mol/L citrate buffer.

• Blocking: Block sections with 3% goat serum to reduce non-specific binding.

• Primary antibody application: Apply CYB561A3 primary antibody at 1:100 dilution and incubate at 4°C overnight.

• Detection system: Apply appropriate secondary antibody and incubate at 37°C for 20 minutes, followed by 3,3′-diaminobenzidine color development.

• Counterstaining: Counterstain with hematoxylin and seal with neutral gum.

• Evaluation: Assess CYB561A3 expression using the Immunoreactive Score system, with scores ≤3 considered negative and scores >3 considered positive for CYB561A3 expression .

This protocol has been validated for detection in breast cancer tissues but may require optimization for other tissue types.

How do I address potential cross-reactivity issues when using CYB561A3 antibodies?

Cross-reactivity can significantly impact experimental outcomes when working with CYB561A3 antibodies. To address this issue:

• Antibody selection: Choose antibodies that have undergone specificity testing. For example, some commercial CYB561A3 antibodies report no significant cross-reactivity or interference between CYB561A3 and its analogs .

• Validation techniques: Employ multiple validation approaches:

  • Use knockout or knockdown cell lines as negative controls

  • Compare results from multiple antibodies targeting different epitopes

  • Include recombinant protein as a positive control

  • Perform peptide competition assays to confirm binding specificity

• Cross-adsorption: Consider using cross-adsorbed secondary antibodies to minimize non-specific interactions.

• Limitations acknowledgment: Understand that despite rigorous testing, cross-reaction may still exist due to limitations in current detection methods for all possible analogs .

• Western blot validation: Before proceeding with more complex applications, validate antibody specificity by Western blot to confirm single band detection at the expected molecular weight.

What are the considerations for quantitative analysis of CYB561 expression in tissue samples?

For accurate quantitative analysis of CYB561 expression in tissue samples, researchers should consider:

• Standardized measurement systems: Utilize established scoring systems such as the Immunoreactive Score for immunohistochemistry or create standard curves for ELISA methods .

• Detection range optimization: Ensure samples fall within the linear detection range of the assay (e.g., 31.25-2000 pg/mL for some ELISA kits) .

• Technical considerations for ELISA:

  • Intra-plate precision: Aim for coefficient of variation (CV) <10%

  • Inter-plate precision: Aim for CV <15%

  • Recovery rates: Consider matrix effects on recovery rates, which typically range from 85-114% for cell culture media and 85-99% for serum samples

• Multi-method validation: When possible, validate expression levels using complementary techniques (e.g., IHC, Western blot, and qRT-PCR) to provide more robust quantification .

• Statistical analysis: Apply appropriate statistical methods when comparing expression levels between groups, accounting for potential confounding factors.

• Reference controls: Include appropriate reference tissues or cell lines with known expression levels for normalization.

How can I design experiments to investigate the role of CYB561A3 in cellular iron homeostasis?

To investigate CYB561A3's role in cellular iron homeostasis, consider the following experimental design approach:

• Genetic manipulation strategies:

  • Generate CYB561A3 knockdown or knockout cell lines using siRNA or CRISPR-Cas9 technology

  • Create overexpression models using expression vectors containing the CYB561A3 gene

• Iron transport assessment methods:

  • Measure intracellular iron levels using colorimetric assays or inductively coupled plasma mass spectrometry (ICP-MS)

  • Track iron movement using fluorescent iron indicators

  • Assess lysosomal iron content using specific staining techniques

• Functional assays:

  • Measure ferrireductase activity in isolated membrane fractions

  • Assess Fe(3+) to Fe(2+) conversion rates in the presence and absence of ascorbate

  • Evaluate iron-dependent cellular processes in CYB561A3-modified cells

• Interaction studies:

  • Identify potential protein-protein interactions with divalent metal transporters

  • Investigate co-localization with endosomal and lysosomal markers

• Physiological relevance:

  • Examine consequences of CYB561A3 modulation on cellular function, particularly under iron starvation or iron overload conditions

  • Assess the impact on oxidative stress markers and mitochondrial function

What approaches can be used to study the relationship between CYB561 and the tumor microenvironment?

To investigate CYB561's relationship with the tumor microenvironment, researchers could implement these methodological approaches:

• Immune cell correlation analysis:

  • Use methods like CIBERSORT algorithm to analyze immune cell infiltration patterns in relation to CYB561 expression

  • Apply single-cell RNA sequencing to characterize cellular heterogeneity and identify cell populations associated with CYB561 expression

• Multi-parameter immunohistochemistry:

  • Perform serial section immunohistochemistry to evaluate correlations between CYB561 and immune markers such as CD163 (M2 macrophages) and CD8 (cytotoxic T cells)

  • Consider multiplex immunofluorescence for simultaneous detection of multiple markers

• Functional co-culture systems:

  • Establish co-culture models of tumor cells with varying CYB561 expression levels and immune cells

  • Assess the impact of CYB561 manipulation on macrophage polarization, T cell activation, and other immune functions

• In vivo models:

  • Develop mouse models with targeted CYB561 expression or knockout in specific cell populations

  • Analyze tumor growth, immune infiltration, and treatment response

• Secretome analysis:

  • Investigate how CYB561 expression affects cytokine and chemokine production

  • Evaluate the impact of conditioned media from CYB561-manipulated cells on immune cell recruitment and polarization

• Mechanistic studies:

  • Explore the relationship between CYB561, NF-κB signaling, and immune regulation

  • Investigate how CYB561-mediated changes in iron homeostasis might influence immune cell function within the tumor microenvironment