ADCK2 Antibody

What is ADCK2 and why is it important for mitochondrial research?

ADCK2 is a mitochondria-locating protein kinase that plays critical roles in fatty acid metabolism and coenzyme Q biosynthesis . As a member of the aarF domain-containing mitochondrial protein kinase family, ADCK2 is essential for maintaining proper mitochondrial function and energy production . Research indicates that ADCK2 haploinsufficiency leads to mitochondrial dysfunction primarily affecting skeletal muscle, with evidence of liver steatosis . The protein's critical involvement in lipid homeostasis through control of the mitochondrial CoQ pool makes it particularly significant for research into metabolic disorders and mitochondrial diseases .

Methodological approach: When initiating ADCK2 research, scientists should first establish baseline expression in relevant tissues using validated antibodies. Mitochondrial fractionation protocols are essential for accurate localization studies, with particular attention to maintaining mitochondrial integrity during isolation.

What are the optimal applications for ADCK2 antibodies in research settings?

ADCK2 antibodies have been successfully validated for multiple research applications:

For optimal results, researchers should validate antibody specificity using positive controls (tissues with known ADCK2 expression) and negative controls (ADCK2 knockout or knockdown samples) . The antibody selection should align with the target species, as most ADCK2 antibodies are primarily reactive with human samples, though some cross-reactivity with mouse and rat has been reported .

How should researchers design ADCK2 knockout/knockdown experiments?

When designing ADCK2 depletion studies, researchers have successfully employed both shRNA and CRISPR/Cas9 approaches:

For shRNA-mediated silencing:

• Lentiviral delivery systems using GV248 vectors have shown high efficiency

• Target verification through both mRNA (~90% reduction) and protein expression analysis is essential

• Inclusion of scramble control (shSCR) is necessary for meaningful comparisons

For CRISPR/Cas9 knockout:

• Effective targeting sequence: GACCCTGACAGACAAACGCC (with PAM sequence AGG)

• Two-step approach: first establish Cas9-expressing stable cell lines, then introduce sgRNA

• Single cell isolation and expansion for homogeneous knockout population

Both approaches resulted in significant phenotypic changes in cancer cells, including reduced viability, decreased proliferation, and induced apoptosis. Researchers should carefully assess off-target effects and confirm knockout efficiency through multiple methods (qPCR, Western blot, and functional assays) .

What protocols are recommended for ADCK2 detection in cell-based assays?

For cell-based ADCK2 detection, the following optimized protocol has shown reliable results:

• Cell preparation:

  • Seed cells at 30,000 cells per well (96-well plate) for adherent cells

  • For suspension cells, pre-coat plates with 10 μg/ml Poly-L-Lysine

  • Allow cells to reach 75-90% confluence before treatment

• Fixation and preparation:

  • Add 100 μl of Fixing Solution (containing 4% paraformaldehyde) for 20 minutes

  • Apply 100 μl of Quenching Buffer to neutralize aldehyde groups

  • Block with 200 μl of Blocking Buffer for 1 hour

• Antibody application:

  • Use primary ADCK2 antibody at recommended dilution (typically 1:100-1:500)

  • Include GAPDH antibody as internal control

  • Incubate overnight at 4°C or 2 hours at room temperature for high-expressing samples

  • Apply appropriate HRP-conjugated secondary antibodies (1:1000-1:5000)

• Detection and normalization:

  • Develop using colorimetric or chemiluminescent substrates

  • Normalize using either GAPDH expression or Crystal Violet staining (OD450/OD595)

This protocol has been successfully used to detect ADCK2 expression in as few as 5,000 cells, making it suitable for limited sample availability .

What is the relationship between ADCK2 expression and cancer progression?

Bioinformatics analyses from TCGA-LUAD/LUSC cohorts revealed that ADCK2 mRNA transcript levels are significantly elevated in non-small cell lung cancer (NSCLC) tissues compared to normal lung epithelial tissues . This overexpression correlates with:

Experimental validation from patient tissues confirms these findings, with:

• Significantly higher ADCK2 mRNA and protein expression in tumor tissues compared to adjacent normal tissue

• 20 primary NSCLC patient samples showing consistent ADCK2 overexpression

• Immunofluorescence and immunohistochemistry confirming cancer-specific upregulation

These findings suggest ADCK2 functions as a potential oncogene in NSCLC, making it an attractive therapeutic target for investigation. Researchers exploring this relationship should consider both transcriptional analysis and protein-level verification across multiple patient samples .

How does ADCK2 depletion affect mitochondrial function in experimental models?

ADCK2 depletion through either shRNA or CRISPR/Cas9 knockout produces profound effects on mitochondrial function:

In cancer cells, ADCK2 silencing or knockout induces significant mitochondrial dysfunction, leading to:

• Robust activation of caspase-3 and caspase-9

• Cleavage of PARP

• Increased histone-bound DNA content

• No change in GSDME (gasdermin E), indicating apoptosis rather than pyroptosis

In mouse models, ADCK2 haploinsufficiency causes:

• Pronounced mitochondrial myopathy in skeletal muscle

• CoQ deficiency

• Significant perturbation in whole-animal mitochondrial β-oxidation

• Impaired fatty acid transport, evidenced by acyl-carnitine profile changes

These findings highlight ADCK2's essential role in maintaining mitochondrial integrity and function.

What are the best practices for validating ADCK2 antibody specificity?

Antibody validation is crucial for reliable ADCK2 research. Comprehensive validation should include:

• Positive controls:

  • Tissues/cells with confirmed high ADCK2 expression (e.g., NSCLC cells)

  • Recombinant ADCK2 protein

  • ADCK2 overexpression models through lentiviral expression systems

• Negative controls:

  • ADCK2 knockdown/knockout samples

  • Pre-absorption with immunizing peptide

  • Secondary antibody-only controls

• Technical validation:

  • Multiple applications testing (WB, IHC, IF)

  • Cross-reactivity assessment with related ADCK family proteins

  • Batch-to-batch consistency verification

• Epitope mapping:

  • For synthetic peptide-derived antibodies, confirm antibody reactivity to the specific region (e.g., AA 257-306 for ABIN6749962)

  • For fusion protein-derived antibodies, confirm specific domain recognition

Antibodies showing high specificity based on these criteria consistently detect ADCK2 at approximately 45 kDa in Western blots and show appropriate subcellular localization in immunofluorescence .

How can researchers effectively measure ADCK2-mediated changes in cell signaling pathways?

ADCK2 depletion significantly impacts multiple signaling pathways, particularly Akt-mTOR signaling in cancer cells. To effectively investigate these interactions:

• Phosphorylation cascade analysis:

  • Assess phosphorylation status of Akt (Ser473, Thr308)

  • Measure mTOR phosphorylation (Ser2448)

  • Evaluate downstream targets: p-S6K1, p-S6, p-4E-BP1

• Temporal dynamics:

  • Time-course experiments (4h, 12h, 24h, 48h post-ADCK2 depletion)

  • Kinase inhibitor rescue experiments

  • Phosphatase inhibitor treatments to validate pathways

• Integration with metabolic signaling:

  • Glucose utilization (2-NBDG uptake)

  • Fatty acid oxidation (palmitate oxidation assay)

  • Mitochondrial respiration (Seahorse analysis)

• In vivo validation:

  • Tissue-specific pathway activation in xenograft models

  • Correlation with tumor growth parameters

  • Response to pathway-specific inhibitors

Research has shown that ADCK2 depletion inactivates Akt-mTOR signaling in NSCLC cells, providing a potential mechanism for its anti-cancer effects .

What experimental strategies can determine the role of ADCK2 in metabolic disorders?

ADCK2 is critical for mitochondrial lipid metabolism, and multiple experimental approaches have successfully examined its role in metabolic disorders:

• Caloric restriction (CR) studies:

  • 40% CR for 7 months in ADCK2+/- mice showed improved glucose homeostasis

  • CR rescued insulin resistance in ADCK2 haploinsufficient mice

  • Fasting glucose and insulin measurements revealed CR-dependent metabolic improvements

• Glucose metabolism assessment:

  • Glucose tolerance test (GTT)

  • Insulin tolerance test (ITT)

  • Pyruvate tolerance test (PTT) for hepatic gluconeogenesis

  • HOMA index calculation

• Lipid metabolism analysis:

  • Acyl-carnitine profiling in plasma (C0, C2, C16, C18)

  • β-hydroxybutyrate levels for ketone body production

  • Free fatty acid quantification

  • Protein expression of β-oxidation enzymes (e.g., ACAA2)

• Satellite cell differentiation:

  • Isolation of adult stem cells

  • Culture with serum from different dietary conditions

  • Assessment of myotube growth, MHC area, length and branching capacity

These methodologies have demonstrated that calorie restriction can rescue metabolic dysfunction in ADCK2 haploinsufficient mice, suggesting dietary interventions as potential therapeutic strategies for ADCK2-related disorders .

How should researchers design immunohistochemical studies for ADCK2 in tissue samples?

For optimal ADCK2 immunohistochemical detection in tissues:

• Sample preparation considerations:

  • FFPE tissue sections (4-6 μm thickness)

  • Fresh-frozen sections for higher sensitivity applications

  • Junction sections containing both normal and cancer tissues for comparative analysis

• Antigen retrieval optimization:

  • Heat-induced epitope retrieval (citrate buffer pH 6.0 or EDTA buffer pH 9.0)

  • Enzymatic retrieval for certain tissue types

  • Optimization based on fixation conditions

• Detection system selection:

  • Polymer-based detection systems for higher sensitivity

  • Chromogenic vs. fluorescent detection depending on research questions

  • Counterstaining with appropriate nuclear stains

• Co-staining strategies:

  • Epithelial markers (e.g., EpCAM) for tissue identification

  • Mitochondrial markers for colocalization studies

  • Cancer markers for comparative expression analysis

• Quantification approach:

  • H-score calculation (intensity × percentage of positive cells)

  • Digital image analysis for objective quantification

  • Statistical comparison between tissue types

In NSCLC studies, researchers successfully used these approaches to demonstrate significantly higher ADCK2 expression in tumor tissues compared to adjacent normal lung tissues, with clear differences visible at the junction of cancer and normal tissues .

What are the key considerations for developing ADCK2-targeting therapeutic strategies?

The emerging role of ADCK2 as a therapeutic target, particularly in cancer, suggests several research directions:

• Target validation approaches:

  • Multiple knockdown/knockout models (shRNA, siRNA, CRISPR)

  • Xenograft tumor models showing significant growth inhibition

  • Correlation with clinical outcomes (survival data from TCGA)

• Mechanism exploration:

  • Mitochondrial function dependency

  • Akt-mTOR signaling pathway involvement

  • Cell cycle and apoptosis regulation

  • Metabolic vulnerabilities

• Combination therapy evaluation:

  • Synergy with immune checkpoint inhibitors

  • Enhanced efficacy with mitochondrial-targeting agents

  • Metabolic pathway inhibitors as adjuncts

• Biomarker development:

  • ADCK2 expression as predictive biomarker for anti-PD-1/PD-L1 therapy response

  • Immune cell infiltration correlation with ADCK2 levels

  • IPS (immunophenoscore) assessment based on ADCK2 expression

• Translational model systems:

  • Patient-derived xenografts

  • Organoid cultures

  • Genetic mouse models

Research has shown that ADCK2 depletion significantly hindered NSCLC xenograft growth in nude mice, suggesting its potential as a therapeutic target .

How can ADCK2 function be rescued in deficiency models?

Rescue experiments provide critical insights into ADCK2's biological functions:

• Genetic rescue approaches:

  • Lentiviral expression of wild-type ADCK2

  • Domain-specific mutant expression to identify critical regions

  • Inducible expression systems for temporal control

• Metabolic rescue strategies:

  • Coenzyme Q supplementation (partially rescued phenotype in human patients)

  • Caloric restriction (40% CR improved metabolic parameters in mouse models)

  • Fatty acid oxidation pathway modulation

• Pharmacological interventions:

  • mTOR pathway modulators

  • Mitochondrial function enhancers

  • Antioxidants targeting mitochondrial ROS

• Verification methods:

  • Functional recovery assessment (ATP production, oxygen consumption)

  • Signaling pathway restoration (Akt-mTOR activity)

  • Phenotypic reversal (cell viability, proliferation, in vivo tumor growth)

Studies have demonstrated that CoQ supplementation partially rescued the phenotype in a male patient with ADCK2 haploinsufficiency, while caloric restriction improved several metabolic parameters in ADCK2+/- mice .

What techniques are most effective for studying ADCK2's role in immune cell infiltration?

ADCK2 expression levels correlate with immune cell infiltration in cancer, necessitating specialized research approaches:

• Computational methods:

  • Gene Set Enrichment Analysis (GSEA) of TCGA datasets

  • Correlation analysis between ADCK2 expression and immune cell markers

  • Immunophenoscore (IPS) calculation for immunotherapy response prediction

• Experimental validation techniques:

  • Multiplex immunofluorescence for simultaneous detection of ADCK2 and immune cell markers

  • Flow cytometry for quantitative assessment of tumor-infiltrating lymphocytes

  • Single-cell RNA sequencing for detailed immune landscape characterization

• Functional assessment:

  • In vitro co-culture systems (cancer cells with immune cells)

  • Cytokine/chemokine profiling after ADCK2 modulation

  • Migration and invasion assays to assess immune cell recruitment

• In vivo models:

  • Syngeneic mouse models with intact immune systems

  • Humanized mouse models for human-specific interactions

  • Response to immune checkpoint inhibitors after ADCK2 modulation

Research has shown that high ADCK2 expression is significantly correlated with reduced enrichment of CD8+ T cells, eosinophils, and mast cells in NSCLC, with implications for immunotherapy response .

How should researchers interpret contradictory ADCK2 expression data across different cancer types?

Resolving conflicting data on ADCK2 expression and function requires systematic approaches:

• Technical validation steps:

  • Antibody specificity confirmation across different lots/sources

  • Multiple detection methods (qPCR, Western blot, IHC)

  • Consistent sample preparation and normalization

• Biological context considerations:

  • Cancer type and subtype heterogeneity

  • Disease stage and progression differences

  • Genetic background variations

  • Tumor microenvironment influence

• Integrated multi-omics approach:

  • Correlation of protein expression with transcriptomic data

  • Epigenetic regulation assessment

  • Post-translational modification analysis

  • Functional genomics validation

• Statistical rigor:

  • Adequate sample sizes for powered studies

  • Multiple testing correction for bioinformatics analyses

  • Appropriate statistical methods for different data types

  • Meta-analysis of multiple studies when available

While ADCK2 appears overexpressed in NSCLC with oncogenic functions, its role may differ in other cancer types or contexts, necessitating comprehensive characterization in each experimental system .

What are the most reliable methods for quantifying ADCK2-dependent mitochondrial dysfunction?

To reliably assess ADCK2's impact on mitochondrial function:

• Bioenergetic profiling:

  • Oxygen consumption rate (OCR) using Seahorse XF analyzer

  • Extracellular acidification rate (ECAR) for glycolytic shift assessment

  • ATP production rate measured through luminescence assays

  • Mitochondrial coupling efficiency

• Structural and integrity analysis:

  • Transmission electron microscopy for ultrastructural changes

  • JC-1 or TMRM staining for membrane potential

  • Mitochondrial mass quantification (MitoTracker, TOM20 staining)

  • Mitochondrial DNA copy number

• Metabolic flux analysis:

  • 13C-labeled substrate tracing

  • Lipid oxidation measurement using 14C-palmitate

  • CoQ levels quantification through HPLC

  • Acyl-carnitine profiling

• Molecular signaling:

  • Mitochondrial stress response (UPRmt) activation

  • Fission/fusion protein expression and localization

  • Mitophagy markers (PINK1, Parkin recruitment)

  • ROS production and antioxidant response