ANPEP Mouse

What is ANPEP and what are its key characteristics in mouse models?

ANPEP (alanyl membrane aminopeptidase), also referred to as CD13, AP-M, AP-N, Apn, or P150, is a transmembrane metalloprotease widely distributed across multiple cell types . In mice, the ANPEP gene is located on chromosome 7 and encodes a protein that functions as a zinc-dependent enzyme involved in protein processing . The mouse ANPEP open reading frame (ORF) consists of 2898 base pairs and is cataloged under the accession number NM_008486 .

ANPEP belongs to the M1 metallopeptidase family and is classified among both aminopeptidases and CD molecules . Its wide distribution across tissues correlates with its involvement in multiple physiological systems including metabolism, development, immune function, cardiovascular system, nervous system, and reproductive processes .

How can I detect and measure ANPEP expression in mouse tissues?

Multiple methodological approaches can be employed to detect and quantify ANPEP expression:

qPCR Analysis:
For gene expression studies, validated qPCR primer pairs are available for mouse ANPEP (NM_008486). The recommended forward sequence is CGAACACCGTTTATCTGGACCTG and reverse sequence is AGCCCATCTGTAGAATCCAGCG . When performing qPCR, the following thermal cycling conditions have been validated on ABI 7900HT systems:

• Activation: 50°C for 2 min

• Pre-soak: 95°C for 10 min

• Cycling (denaturation/annealing): 95°C for 15 sec, 60°C for 1 min

• Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec

Immunofluorescence Imaging:
Confocal microscopy using ANPEP-specific antibodies has successfully demonstrated expression patterns in tissues such as gastric epithelium, where ANPEP specifically marks mature zymogenic chief cells (ZCs) without overlap with ZC-precursor markers . This approach allows visualization of both intracellular and plasma membrane expression patterns .

Expression Constructs:
For functional studies requiring ANPEP overexpression, lentiviral ORF expression systems with fluorescent tags (such as mGFP) are available. These systems include puromycin selection markers for stable cell line development .

What mouse models are available for studying ANPEP function?

Two primary genetic models exist for studying ANPEP function in mice:

APN-null (Knockout) Mouse:
A complete knockout model has been generated and characterized, allowing researchers to study the consequences of global ANPEP deficiency . Despite ANPEP's wide distribution across tissues, these mice develop normally without gross or histological abnormalities and display no alterations in standard neurological, cardiovascular, metabolic, locomotor, or hematological parameters .

Conditional Knockout (cKO) Model:
A conditional knockout mouse strain (C57BL/6JGpt-Anpep/Gpt em1Cflox) has been generated using Cre-loxP technology . This model features loxP sites flanking a 19,293 bp region of the ANPEP gene, enabling tissue-specific or temporally controlled deletion when crossed with appropriate Cre-expressing lines . This conditional approach is particularly valuable for dissecting tissue-specific functions without developmental compensation.

How should I genotype ANPEP mouse models?

Genotyping protocols are specific to each genetic model:

For the Conditional Knockout Model:
The C57BL/6JGpt-Anpep/Gpt em1Cflox strain requires specific PCR protocols for accurate genotyping, which are available from the developer (referenced as "T018308.Anpep Genotyping Protocol(CKO).pdf" in the strain information) . These protocols typically involve PCR amplification across loxP sites to distinguish between wild-type, heterozygous, and homozygous floxed alleles.

While reconstituting genotyping primers, it's recommended to prepare working solutions at 10 μM concentration. Typically, PCR conditions should be optimized for the specific primers, but generally involve standard three-step PCR protocols followed by gel electrophoresis to visualize band patterns specific to each genotype.

What is the role of ANPEP in pathological angiogenesis?

ANPEP has been identified as a critical regulator of pathological angiogenesis, showing a remarkable dichotomy between normal and disease-associated vascular development. Research using APN-null mice has yielded several key insights:

Pathological vs. Physiological Angiogenesis:
APN-null mice exhibit normal physiological development of the vascular system but show a marked and dose-dependent deficiency in pathological neovascularization . In oxygen-induced retinopathy experiments, these mice demonstrated significantly impaired retinal neovascularization compared to wild-type controls .

Growth Factor Response:
When tested with growth factor-embedded gelfoams, APN-null mice failed to develop functional blood vessels, further confirming ANPEP's critical role in the angiogenic response to pathological stimuli . This suggests ANPEP functions as a regulatory switch that distinguishes between developmental and pathological angiogenic processes.

The methodological implications of these findings are significant for researchers studying vascular biology, particularly those developing anti-angiogenic therapies for cancer or retinopathies. ANPEP inhibition may offer a therapeutic approach that selectively targets pathological vessel formation while sparing normal vascular development.

How is ANPEP expression regulated in gastric epithelial cells and what role does it play in metaplasia?

ANPEP shows cell-type specific expression in the gastric epithelium with important implications for understanding stomach pathophysiology:

Cell-Type Specific Expression Pattern:
Immunofluorescence studies have demonstrated that ANPEP is expressed exclusively in mature zymogenic chief cells (ZCs) in both mouse and human stomachs, but not in ZC-precursor cells . This expression pattern makes ANPEP a valuable marker for identifying fully differentiated ZCs in the gastric epithelium.

ANPEP Expression During Metaplastic Changes:
During gastric injury and inflammation, ANPEP expression is significantly altered. Research has shown that ANPEP expression is lost in ZCs upon induction of gastric metaplasia . This pattern extends to infection models - in mice colonized by Helicobacter pylori (HP), which causes parietal cell atrophy and ZC reprogramming into Spasmolytic Polypeptide-Expressing Metaplasia (SPEM), ANPEP expression is dramatically reduced .

Regulation Independent of MIST1:
Analysis of ZCs from wild-type and Mist1-/- mice revealed that Anpep expression increases approximately 10-fold in mature ZCs compared to mucous neck cell precursors in both genotypes, indicating that ANPEP expression is not dependent on the transcription factor MIST1 .

These findings establish ANPEP as both a marker and potential regulator of gastric epithelial differentiation, with implications for research on gastric cancer progression, as HP infection and the associated metaplastic changes significantly increase gastric cancer risk.

What are the methodological considerations for isolating ANPEP-expressing cells from mouse tissues?

ANPEP's expression on the plasma membrane makes it valuable for cell isolation, particularly for obtaining pure populations of specific cell types:

FACS-Based Isolation:
Since ANPEP (CD13) is expressed on the cell surface, fluorescence-activated cell sorting (FACS) using anti-ANPEP antibodies provides an effective method for isolating ANPEP-positive cells. This approach has been particularly valuable for isolating zymogenic chief cells from gastric epithelium, as ANPEP specifically marks these mature cells without overlapping with precursor populations .

Cell Type Verification:
When isolating ANPEP-positive cells, verification of cell identity is crucial. For gastric ZCs, co-staining for established ZC markers such as pepsinogen C (PGC) and gastric intrinsic factor (GIF, in mice) can confirm proper isolation . Conversely, the absence of neck cell markers like TFF2 and GSII should be verified.

Considerations for Pathological Conditions:
Researchers should note that ANPEP expression can change dramatically during pathological conditions. For instance, during gastric metaplasia induced by high-dose tamoxifen treatment or Helicobacter pylori infection, ANPEP expression in ZCs is substantially reduced . Therefore, isolation protocols may require adjustment when working with disease models.

What are the key experimental considerations when using ANPEP expression vectors in cell culture systems?

When employing ANPEP expression vectors for in vitro studies, several methodological considerations are critical:

Vector Selection and Preparation:
Lentiviral expression vectors containing the mouse ANPEP ORF (such as pLenti-C-mGFP-P2A-Puro) provide efficient delivery and stable expression in mammalian cells . When working with these plasmids:

• Purification: Ion-exchange column purified plasmid DNA is typically supplied in a dried format (10 μg) requiring reconstitution

• Reconstitution protocol: Centrifuge at 5,000 × g for 5 minutes, carefully add 100 μl sterile water, incubate for 10 minutes at room temperature, briefly vortex, then quick spin to concentrate liquid at the bottom

• Storage: Store reconstituted plasmid at -20°C, where it remains stable for at least one year

Selection and Expression Verification:
For establishing stable cell lines:

• Mammalian cell selection: Use puromycin at appropriate concentrations for the cell line being used

• Expression verification: The mGFP tag facilitates visualization of expression via fluorescence microscopy

• Expression variability: Note that expression levels can vary depending on the nature of the gene and the cell type used

Sterility Considerations:
Standard plasmid preparations are not sterile. For experiments requiring strict sterility, filtration with a 0.22 μm filter is required .

How do mouse and human ANPEP compare, and what are the implications for translational research?

Understanding the similarities and differences between mouse and human ANPEP is crucial for translating findings from mouse models to human applications:

Expression Pattern Similarities:
Immunofluorescence studies have demonstrated that ANPEP expression patterns in gastric epithelium are conserved between mice and humans, with specific expression in mature zymogenic chief cells in both species . This conservation suggests functional similarities and supports the use of mouse models for studying ANPEP's role in gastric biology.

Conservation of Pathological Implications:
The alteration of ANPEP expression during pathological conditions appears to be conserved across species. For example, studies have shown that expression of ANPEP is altered during tumorigenesis in both mice and humans . In human prostate cancer, loss of ANPEP has been identified as an adverse prognostic factor .

Methodological Considerations for Cross-Species Research:
When designing experiments to translate findings from mouse models to human applications, researchers should consider:

• Antibody cross-reactivity: Verify whether antibodies recognize epitopes conserved between species

• Functional assays: Validate that functional readouts are relevant to both mouse and human biology

• Pathway conservation: Confirm that regulatory pathways controlling ANPEP expression are conserved

These considerations are particularly important for researchers developing therapeutic strategies targeting ANPEP in human diseases based on mouse model findings.

How can ANPEP mouse models contribute to understanding metaplasia-associated cancer progression?

ANPEP mouse models offer significant value for studying the progression from metaplasia to neoplasia, particularly in gastric cancer:

Marker of Differentiation State:
ANPEP's specific expression in mature zymogenic chief cells makes it a valuable marker for tracking cellular differentiation states during metaplastic progression . The loss of ANPEP expression observed during metaplasia may serve as an early indicator of pathological reprogramming.

Potential Role in Helicobacter pylori-Induced Pathology:
Research has demonstrated that Helicobacter pylori infection, which significantly increases gastric cancer risk, leads to decreased ANPEP expression as part of the metaplastic response . The high-dose tamoxifen protocol used in some studies provides a rapid, reversible model for the effects of HP infection, allowing researchers to study these changes in a controlled manner .

Implications for Cancer Progression:
The observation that ANPEP expression is altered during tumorigenesis in multiple cancer types suggests that changes in ANPEP may play a functional role in cancer progression . Studies showing that loss of ANPEP is an adverse prognostic factor in prostate cancer further support this connection .

By leveraging both global knockout and conditional knockout mouse models of ANPEP, researchers can dissect the specific contributions of this protein to different stages of metaplasia and cancer progression, potentially identifying new therapeutic targets or prognostic markers.