APBA3 Antibody

Shipped with Ice Packs
In Stock

Product Specs

Buffer
Liquid in phosphate-buffered saline (PBS) containing 50% glycerol, 0.5% bovine serum albumin (BSA), and 0.02% sodium azide.
Form
Liquid
Lead Time
Typically, we can ship the products within 1-3 business days after receiving your orders. Delivery time may vary depending on the purchase method or location. Please consult your local distributors for specific delivery times.
Synonyms
Adapter protein X11gamma antibody; amyloid beta (A4) precursor protein binding; family A; member 3 antibody; Amyloid beta A4 precursor protein-binding family A member 3 antibody; Amyloid beta precursor protein binding; family A; member 3 phosphotyrosine binding/ interacting domain (PTB) bearing protein antibody; APBA3 antibody; APBA3_HUMAN antibody; lin 10 antibody; MGC:15815 antibody; Mint 3 antibody; Mint-3 antibody; Neuron specific X11L2 protein antibody; Neuron-specific X11L2 protein antibody; Neuronal Munc18 1 interacting protein 3 antibody; Neuronal Munc18-1-interacting protein 3 antibody; phosphotyrosine binding/interacting domain (PTB) bearing protein antibody; X11 like 2 protein 2 antibody; X11gamma antibody; X11L2 antibody
Target Names
APBA3
Uniprot No.

Target Background

Function
This antibody may modulate the processing of the amyloid-beta precursor protein (APP), potentially influencing the formation of APP-beta. It may also enhance the activity of hypoxia-inducible factor 1 alpha (HIF1A) in macrophages by inhibiting the activity of HIF1AN.
Gene References Into Functions
  1. Research suggests that NECAB3, a novel Mint3-binding protein, activates HIF-1 to promote normoxic glycolysis and tumorigenicity by forming a ternary complex with Mint3 and FIH-1. PMID: 26948053
  2. The FIH-1-Mint3 axis does not regulate HIF-1 transcriptional activity in nucleus pulposus cells. PMID: 24867948
  3. Mints are essential for activity-induced APP and PS1 trafficking, providing insight into the cellular fate of APP in endocytic pathways crucial for Abeta production. PMID: 24742670
  4. Studies have demonstrated strict specificity for the recruitment of the Mint3 adaptor by APP at the Golgi apparatus, with a critical role for tyrosine 682 (within the YENPTY motif) in Mint3 recruitment and APP export from the Golgi. PMID: 23965993
  5. These findings indicate that all three amyloid beta protein precursor family members are capable of activating gene transcription via Mint3-Taz and Mint3-Yap. PMID: 21178287
  6. Two transcriptional coactivators, TAZ and YAP, functionally interact with amyloid precursor protein through Mint3 and form transcriptionally active triple protein complexes. PMID: 20016085
  7. This antibody is associated with the etiological mechanism of Alzheimer's disease. PMID: 11831025
  8. Mint-3 regulates the retrieval of the internalized membrane-type matrix metalloproteinase, MT5-MMP, to the plasma membrane by binding to its carboxyl end motif EWV. PMID: 14990567
  9. Research has examined the ability of Bcr to interact with other epithelial PDZ proteins and found specific binding to both the apical PDZK1 protein and the Golgi-localized Mint3. PMID: 15494376
  10. These data suggest that Mint3 activity is a critical determinant of post-Golgi APP traffic. PMID: 17959829
  11. The interaction between the PTB domain of Mint3 and the acidic peptide signal of Furin regulates the specific localization of Furin in the trans-Golgi network. PMID: 18544638
  12. Mint3 regulates the FIH-1-HIF-1 pathway, which controls ATP production in macrophages. PMID: 19726677
Database Links

HGNC: 580

OMIM: 604262

KEGG: hsa:9546

STRING: 9606.ENSP00000315136

UniGene: Hs.25527

Subcellular Location
Cytoplasm, perinuclear region.
Tissue Specificity
Expressed in all tissues examined with lower levels in brain and testis.

Q&A

What is APBA3/Mint3 and which antibodies are available for its detection?

APBA3/Mint3 is a protein involved in regulating glycolysis via HIF-1 activation, particularly in monocytes/macrophages, and plays a crucial role in cancer metastasis. Several validated antibodies are available:

AntibodyHostReactivityApplicationsImmunogen Region
A07396-2 (Picoband)RabbitHumanELISA, WB-
A07396-1RabbitHuman, Mouse, RatELISA, IF, IHC, ICC, WBaa 361-410
ABIN968505MouseHuman, MouseWB, IF, BioImagingaa 63-185
ABIN926957RabbitHuman, DogWBN-Terminal
NBP3-06040RabbitHumanWB, ICC/IF, IHC-

The choice depends on your specific application and target species .

What is the observed molecular weight of APBA3 in Western blot applications?

While the calculated molecular weight of APBA3 is approximately 61 kDa, it typically appears at approximately 69-72 kDa in Western blot analysis. This discrepancy is consistent across multiple antibodies and may reflect post-translational modifications. In validation studies using human cell lines:

  • HEK293, HeLa, and PC-3 cells show a specific band at approximately 69 kDa

  • A431 cells also demonstrate a strong band at the expected size

Always include appropriate positive controls such as HeLa or HEK293 cell lysates when validating your antibody .

How should APBA3 antibodies be stored to maintain reactivity?

For optimal antibody performance:

  • Store lyophilized antibodies at -20°C for up to one year from receipt date

  • After reconstitution, store at 4°C for one month or aliquot and store at -20°C for six months

  • For liquid antibodies, store at -20°C for long-term storage and at 4°C for frequent use up to one month

  • Avoid repeated freeze-thaw cycles as this significantly reduces antibody activity

Some antibodies (like NBP3-06040) show stability for twelve months from date of receipt when properly stored .

What are the recommended protocols for using APBA3 antibodies in Western blot applications?

For optimal Western blot detection of APBA3:

  • Sample preparation: Use 30 μg of whole cell lysate under reducing conditions

  • Electrophoresis: Run on 5-20% SDS-PAGE at 70V (stacking)/90V (resolving) for 2-3 hours

  • Transfer: Transfer to nitrocellulose at 150 mA for 50-90 minutes

  • Blocking: Use 5% non-fat milk in TBS for 1.5 hours at room temperature

  • Primary antibody incubation:

    • A07396-2: 0.5 μg/mL overnight at 4°C

    • A07396-1: 1:500-1:2000 dilution

    • Other antibodies: Follow manufacturer's recommendations

  • Washing: TBS with 0.1% Tween, 3 times, 5 minutes each

  • Secondary antibody: Goat anti-rabbit/mouse IgG-HRP at 1:5000-1:10000 for 1.5 hours

  • Detection: Use enhanced chemiluminescence detection system

Positive controls include human HEK293, HeLa, and PC-3 whole cell lysates .

How can I optimize APBA3 detection in immunofluorescence or immunocytochemistry studies?

For successful immunofluorescence detection of APBA3:

  • Fixation: Use 4% paraformaldehyde to preserve cellular structure

  • Permeabilization: 0.1% Triton X-100 in PBS allows antibody access to intracellular targets

  • Blocking: 10% serum (matching secondary antibody species) reduces background

  • Primary antibody:

    • A07396-1: Use at 1:50-1:200 dilution

    • NBP3-06040: Use at 1:200 dilution

  • Incubation: Overnight at 4°C for optimal binding

  • Secondary antibody: Alexa Fluor 488-conjugated anti-rabbit/mouse IgG

  • Nuclear counterstain: DAPI works well for nuclear visualization

  • Expected localization: Primarily cytoplasmic staining

Validation studies with U2OS cells show clear cytoplasmic localization of APBA3 .

What controls should be included when using APBA3 antibodies in functional studies?

To ensure scientific rigor when studying APBA3 function:

  • Positive tissue/cell controls:

    • Human cell lines: HEK293, HeLa, PC-3, A431

    • Mouse tissues: Consider using tissues from APBA3 knockout vs. wild-type mice

  • Negative controls:

    • Primary antibody omission

    • Isotype control antibody

    • Tissues/cells from APBA3 knockout models

  • Specificity validation:

    • Peptide competition assays (blocking peptides available for some antibodies)

    • siRNA knockdown or CRISPR knockout validation

    • Compare results with multiple antibodies targeting different epitopes

  • Cross-reactivity assessment:

    • When studying new species, perform careful validation before proceeding with full experiments .

How can APBA3 antibodies be utilized to study metastatic niche formation?

APBA3 plays a critical role in metastatic niche formation through several mechanisms that can be investigated using specific antibodies:

  • Co-localization studies:

    • Combine APBA3 antibodies with markers for inflammatory monocytes (CD115, Ly-6C, CCR2)

    • Dual staining with endothelial markers (CD31) and E-selectin

  • APBA3-HIF-1 pathway analysis:

    • Use APBA3 antibodies alongside HIF-1α detection to study the pathway in tumor-associated macrophages

    • Compare expression in normoxic vs. hypoxic conditions

  • Metastatic site examination:

    • Immunohistochemistry of lung sections using APBA3 antibodies (1:100-1:300) to identify infiltrating monocytes

    • Correlate with E-selectin expression in endothelial cells

  • In vivo models:

    • Compare APBA3 expression in wild-type vs. knockout mouse models during metastasis

    • Analyze samples at different timepoints (4h, 24h) after tumor cell inoculation

Research has shown that host APBA3 deficiency decreases lung metastasis of B16F10, LLC, and 4T1 cancer cells by reducing E-selectin expression in lung endothelial cells .

What is the mechanism by which APBA3 promotes cancer metastasis?

APBA3 supports metastasis through a multi-step mechanism that can be studied using specific antibodies:

  • Inflammatory monocyte activation:

    • APBA3 activates HIF-1 in CCR2+ inflammatory monocytes

    • This activation maintains glycolysis-dependent functions even under normoxic conditions

  • VEGFA production:

    • APBA3-dependent HIF-1 activation induces VEGFA expression in monocytes

    • VEGFA can be detected using specific antibodies in conjunction with APBA3 staining

  • Endothelial E-selectin induction:

    • VEGFA produced by monocytes induces E-selectin expression in endothelial cells

    • E-selectin promotes tumor cell adhesion and extravasation

  • Extravasation facilitation:

    • APBA3-dependent mechanisms help tumor cells leave blood vessels and colonize target organs

    • This can be visualized using whole-mount staining with CD31 and tumor cell tracking

Research with APBA3-deficient mice shows that only 25% of tumor cells successfully invade the interstitium in APBA3-knockout lungs compared to 50% in wild-type mice .

How does APBA3 regulate glycolysis in macrophages and how can this be measured?

APBA3 regulates glycolysis in macrophages through HIF-1 activation, which can be investigated using these approaches:

  • ATP production assessment:

    • APBA3 deficiency reduces ATP production in macrophages to approximately 60% of normal levels

    • Use luciferase-based ATP assays in conjunction with APBA3 antibody validation

  • Glycolytic enzyme expression:

    • Compare expression of glycolytic enzymes (HK1, HK2, PFKL, LDHA) in wild-type vs. APBA3-deficient macrophages

    • Use RT-qPCR with primers specific for glycolytic enzymes (see table below)

  • Metabolic flux analysis:

    • Measure extracellular acidification rate (ECAR) in macrophages with varying APBA3 expression

    • Combine with oxygen consumption rate (OCR) measurements

  • 2-DG sensitivity testing:

    • APBA3-dependent macrophages are particularly sensitive to glycolysis inhibition

    • Compare the effects of 2-DG treatment on wild-type vs. APBA3-deficient cells

PrimerForward (5′–3′)Reverse (5′–3′)
Slc2a1GGGCATGTGCTTCCAGTATGTACGAGGAGCACCGTGAAGAT
Hk1GGGCACCATGATGACTTGTGGTAGCAGGCATTGCTGCCAG
PfklTCATCATCGCAGAGGGTGCCAAGCCCAGCCTCTGAACCAC
LdhaCTCCAAGCTGGTCATTATCACCCCACGTAGGTCAAGATATCC

Studies show that APBA3-deficient mice demonstrate resistance to LPS-induced septic shock due to reduced glycolytic capacity in macrophages .

How can I troubleshoot non-specific binding when using APBA3 antibodies?

When encountering non-specific binding with APBA3 antibodies:

  • Optimize blocking conditions:

    • Try different blocking agents (5% BSA, 5-10% normal serum, commercial blockers)

    • Increase blocking time to 2 hours at room temperature

  • Adjust antibody concentration:

    • Perform a titration series (e.g., 1:100, 1:500, 1:1000, 1:2000)

    • For Western blot, start with 0.1-0.5 μg/ml for Picoband antibodies

  • Increase washing stringency:

    • Add additional wash steps (5 instead of 3)

    • Increase Tween-20 concentration slightly (up to 0.3%)

    • Extend washing times to 10 minutes per wash

  • Validate with multiple antibodies:

    • Compare results using antibodies targeting different epitopes

    • Use APBA3-knockout samples as negative controls

  • Pre-absorb the antibody:

    • Incubate with non-specific proteins before application to reduce cross-reactivity

    • Consider using a blocking peptide if available .

How should I interpret differences in APBA3 expression between tumor and normal tissues?

When analyzing APBA3 expression patterns:

  • Cell type-specific expression:

    • APBA3 is strongly expressed in monocytes/macrophages

    • Lower expression in other cell types is normal

    • Use dual staining with cell type-specific markers (CD68, CD11b) for proper interpretation

  • Localization changes:

    • APBA3 is primarily cytoplasmic in normal cells

    • Alterations in subcellular localization may indicate functional changes

    • Compare with HIF-1α localization in the same samples

  • Quantification approaches:

    • Use digital image analysis to quantify staining intensity

    • Normalize to appropriate housekeeping proteins for Western blot

    • Present data as fold-change relative to control samples

  • Metastatic vs. primary tumor analysis:

    • APBA3 may show different patterns in primary tumors vs. metastatic sites

    • Focus on the tumor microenvironment, particularly infiltrating monocytes

    • E-selectin expression in endothelial cells correlates with APBA3 activity .

How can I determine if an APBA3 antibody will cross-react with tissues from species not listed in the datasheet?

When testing APBA3 antibodies in new species:

  • Sequence homology analysis:

    • Compare the immunogen sequence across species using alignment tools

    • Higher homology (>80%) suggests potential cross-reactivity

  • Step-wise validation:

    • Start with Western blot to confirm band at expected molecular weight

    • Proceed to IHC/IF only after Western blot validation

    • Include known positive control tissue alongside test samples

  • Multiple antibody approach:

    • Test multiple antibodies targeting different epitopes

    • Concordant results increase confidence in cross-reactivity

  • Knockout/knockdown controls:

    • If available, include tissue from APBA3-deficient animals of the test species

    • Alternatively, use siRNA knockdown in cultured cells from the test species

As noted in a customer question to Bosterbio, while an antibody might not be validated for a specific species (e.g., goat), cross-reactivity is possible and can be tested through an innovator award program .

How can APBA3 antibodies be used to investigate the APBA3-HIF-1 pathway in disease models?

For investigating the APBA3-HIF-1 pathway:

  • Co-immunoprecipitation studies:

    • Use APBA3 antibodies to pull down protein complexes

    • Detect HIF-1α and FIH-1 (factor inhibiting HIF-1) in the immunoprecipitates

    • Compare results in normoxia vs. hypoxia

  • Chromatin immunoprecipitation (ChIP):

    • Analyze HIF-1 binding to target promoters in wild-type vs. APBA3-deficient cells

    • Focus on glycolytic enzyme genes and VEGFA promoter regions

  • Proximity ligation assay:

    • Detect protein-protein interactions between APBA3 and pathway components

    • Visualize interactions in situ in tissue sections

  • Disease model applications:

    • Compare APBA3 expression in inflammation models (e.g., LPS-induced sepsis)

    • Analyze expression in cancer metastasis models at different timepoints

    • Correlate with disease progression and outcomes

The APBA3-HIF-1 pathway can be therapeutically targeted, as APBA3 deficiency specifically affects macrophage function without impacting other cell types significantly .

What are the considerations when designing experiments to study APBA3 in specialized cell populations?

When studying APBA3 in specific cell populations:

  • Cell isolation techniques:

    • For monocytes/macrophages, use CD115, CCR2, or Ly-6C as sorting markers

    • Flow cytometry can separate inflammatory from resident macrophages

    • Magnetic bead-based isolation provides higher cell yields

  • Conditional knockout approaches:

    • Use LysM-Cre for myeloid-specific APBA3 deletion

    • Compare with global APBA3 knockout to distinguish cell-autonomous effects

  • In vivo tracking:

    • Label isolated cells with fluorescent dyes before adoptive transfer

    • Use reporter mice (e.g., GFP under APBA3 promoter) to track expression

  • Single-cell analysis:

    • Combine APBA3 antibodies with additional markers for heterogeneity assessment

    • Consider single-cell RNA-seq to correlate APBA3 with global expression patterns

Research using myeloid-specific APBA3 knockout (LysM-Cre x APBA3-floxed) mice has confirmed that macrophage-specific APBA3 deletion recapitulates many aspects of global knockout phenotypes .

How do modifications of the APBA3 protein affect antibody recognition and function?

Understanding APBA3 modifications is crucial for antibody selection:

  • Post-translational modifications:

    • Phosphorylation can alter antibody recognition

    • Western blot analysis might reveal multiple bands reflecting modified forms

    • Treat samples with phosphatases to confirm modification status

  • Truncated variants:

    • APBA3-NT (amino acids 1-214) has been used in functional studies

    • Antibodies targeting different regions may yield varying results

    • Consider using antibodies against N-terminal, C-terminal, and internal regions

  • Domain-specific functions:

    • APBA3 contains protein-protein interaction domains

    • Antibodies targeting specific domains might interfere with function

    • Use epitope mapping to understand antibody binding sites

  • Experimental considerations:

    • For functional studies, ensure antibodies don't interfere with key interactions

    • For detection only, multiple antibodies can provide comprehensive coverage

Expression constructs for APBA3-NT and lentiviral vectors carrying APBA3 cDNA can be useful tools for functional validation .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.