APBA3/Mint3 is a protein involved in regulating glycolysis via HIF-1 activation, particularly in monocytes/macrophages, and plays a crucial role in cancer metastasis. Several validated antibodies are available:
| Antibody | Host | Reactivity | Applications | Immunogen Region |
|---|---|---|---|---|
| A07396-2 (Picoband) | Rabbit | Human | ELISA, WB | - |
| A07396-1 | Rabbit | Human, Mouse, Rat | ELISA, IF, IHC, ICC, WB | aa 361-410 |
| ABIN968505 | Mouse | Human, Mouse | WB, IF, BioImaging | aa 63-185 |
| ABIN926957 | Rabbit | Human, Dog | WB | N-Terminal |
| NBP3-06040 | Rabbit | Human | WB, ICC/IF, IHC | - |
The choice depends on your specific application and target species .
While the calculated molecular weight of APBA3 is approximately 61 kDa, it typically appears at approximately 69-72 kDa in Western blot analysis. This discrepancy is consistent across multiple antibodies and may reflect post-translational modifications. In validation studies using human cell lines:
HEK293, HeLa, and PC-3 cells show a specific band at approximately 69 kDa
A431 cells also demonstrate a strong band at the expected size
Always include appropriate positive controls such as HeLa or HEK293 cell lysates when validating your antibody .
For optimal antibody performance:
Store lyophilized antibodies at -20°C for up to one year from receipt date
After reconstitution, store at 4°C for one month or aliquot and store at -20°C for six months
For liquid antibodies, store at -20°C for long-term storage and at 4°C for frequent use up to one month
Avoid repeated freeze-thaw cycles as this significantly reduces antibody activity
Some antibodies (like NBP3-06040) show stability for twelve months from date of receipt when properly stored .
For optimal Western blot detection of APBA3:
Sample preparation: Use 30 μg of whole cell lysate under reducing conditions
Electrophoresis: Run on 5-20% SDS-PAGE at 70V (stacking)/90V (resolving) for 2-3 hours
Transfer: Transfer to nitrocellulose at 150 mA for 50-90 minutes
Blocking: Use 5% non-fat milk in TBS for 1.5 hours at room temperature
Primary antibody incubation:
A07396-2: 0.5 μg/mL overnight at 4°C
A07396-1: 1:500-1:2000 dilution
Other antibodies: Follow manufacturer's recommendations
Washing: TBS with 0.1% Tween, 3 times, 5 minutes each
Secondary antibody: Goat anti-rabbit/mouse IgG-HRP at 1:5000-1:10000 for 1.5 hours
Detection: Use enhanced chemiluminescence detection system
Positive controls include human HEK293, HeLa, and PC-3 whole cell lysates .
For successful immunofluorescence detection of APBA3:
Fixation: Use 4% paraformaldehyde to preserve cellular structure
Permeabilization: 0.1% Triton X-100 in PBS allows antibody access to intracellular targets
Blocking: 10% serum (matching secondary antibody species) reduces background
Primary antibody:
A07396-1: Use at 1:50-1:200 dilution
NBP3-06040: Use at 1:200 dilution
Incubation: Overnight at 4°C for optimal binding
Secondary antibody: Alexa Fluor 488-conjugated anti-rabbit/mouse IgG
Nuclear counterstain: DAPI works well for nuclear visualization
Expected localization: Primarily cytoplasmic staining
Validation studies with U2OS cells show clear cytoplasmic localization of APBA3 .
To ensure scientific rigor when studying APBA3 function:
Positive tissue/cell controls:
Human cell lines: HEK293, HeLa, PC-3, A431
Mouse tissues: Consider using tissues from APBA3 knockout vs. wild-type mice
Negative controls:
Primary antibody omission
Isotype control antibody
Tissues/cells from APBA3 knockout models
Specificity validation:
Peptide competition assays (blocking peptides available for some antibodies)
siRNA knockdown or CRISPR knockout validation
Compare results with multiple antibodies targeting different epitopes
Cross-reactivity assessment:
APBA3 plays a critical role in metastatic niche formation through several mechanisms that can be investigated using specific antibodies:
Co-localization studies:
Combine APBA3 antibodies with markers for inflammatory monocytes (CD115, Ly-6C, CCR2)
Dual staining with endothelial markers (CD31) and E-selectin
APBA3-HIF-1 pathway analysis:
Use APBA3 antibodies alongside HIF-1α detection to study the pathway in tumor-associated macrophages
Compare expression in normoxic vs. hypoxic conditions
Metastatic site examination:
Immunohistochemistry of lung sections using APBA3 antibodies (1:100-1:300) to identify infiltrating monocytes
Correlate with E-selectin expression in endothelial cells
In vivo models:
Compare APBA3 expression in wild-type vs. knockout mouse models during metastasis
Analyze samples at different timepoints (4h, 24h) after tumor cell inoculation
Research has shown that host APBA3 deficiency decreases lung metastasis of B16F10, LLC, and 4T1 cancer cells by reducing E-selectin expression in lung endothelial cells .
APBA3 supports metastasis through a multi-step mechanism that can be studied using specific antibodies:
Inflammatory monocyte activation:
APBA3 activates HIF-1 in CCR2+ inflammatory monocytes
This activation maintains glycolysis-dependent functions even under normoxic conditions
VEGFA production:
APBA3-dependent HIF-1 activation induces VEGFA expression in monocytes
VEGFA can be detected using specific antibodies in conjunction with APBA3 staining
Endothelial E-selectin induction:
VEGFA produced by monocytes induces E-selectin expression in endothelial cells
E-selectin promotes tumor cell adhesion and extravasation
Extravasation facilitation:
APBA3-dependent mechanisms help tumor cells leave blood vessels and colonize target organs
This can be visualized using whole-mount staining with CD31 and tumor cell tracking
Research with APBA3-deficient mice shows that only 25% of tumor cells successfully invade the interstitium in APBA3-knockout lungs compared to 50% in wild-type mice .
APBA3 regulates glycolysis in macrophages through HIF-1 activation, which can be investigated using these approaches:
ATP production assessment:
APBA3 deficiency reduces ATP production in macrophages to approximately 60% of normal levels
Use luciferase-based ATP assays in conjunction with APBA3 antibody validation
Glycolytic enzyme expression:
Compare expression of glycolytic enzymes (HK1, HK2, PFKL, LDHA) in wild-type vs. APBA3-deficient macrophages
Use RT-qPCR with primers specific for glycolytic enzymes (see table below)
Metabolic flux analysis:
Measure extracellular acidification rate (ECAR) in macrophages with varying APBA3 expression
Combine with oxygen consumption rate (OCR) measurements
2-DG sensitivity testing:
APBA3-dependent macrophages are particularly sensitive to glycolysis inhibition
Compare the effects of 2-DG treatment on wild-type vs. APBA3-deficient cells
| Primer | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| Slc2a1 | GGGCATGTGCTTCCAGTATGT | ACGAGGAGCACCGTGAAGAT |
| Hk1 | GGGCACCATGATGACTTGTG | GTAGCAGGCATTGCTGCCAG |
| Pfkl | TCATCATCGCAGAGGGTGCC | AAGCCCAGCCTCTGAACCAC |
| Ldha | CTCCAAGCTGGTCATTATCACC | CCACGTAGGTCAAGATATCC |
Studies show that APBA3-deficient mice demonstrate resistance to LPS-induced septic shock due to reduced glycolytic capacity in macrophages .
When encountering non-specific binding with APBA3 antibodies:
Optimize blocking conditions:
Try different blocking agents (5% BSA, 5-10% normal serum, commercial blockers)
Increase blocking time to 2 hours at room temperature
Adjust antibody concentration:
Perform a titration series (e.g., 1:100, 1:500, 1:1000, 1:2000)
For Western blot, start with 0.1-0.5 μg/ml for Picoband antibodies
Increase washing stringency:
Add additional wash steps (5 instead of 3)
Increase Tween-20 concentration slightly (up to 0.3%)
Extend washing times to 10 minutes per wash
Validate with multiple antibodies:
Compare results using antibodies targeting different epitopes
Use APBA3-knockout samples as negative controls
Pre-absorb the antibody:
When analyzing APBA3 expression patterns:
Cell type-specific expression:
APBA3 is strongly expressed in monocytes/macrophages
Lower expression in other cell types is normal
Use dual staining with cell type-specific markers (CD68, CD11b) for proper interpretation
Localization changes:
APBA3 is primarily cytoplasmic in normal cells
Alterations in subcellular localization may indicate functional changes
Compare with HIF-1α localization in the same samples
Quantification approaches:
Use digital image analysis to quantify staining intensity
Normalize to appropriate housekeeping proteins for Western blot
Present data as fold-change relative to control samples
Metastatic vs. primary tumor analysis:
When testing APBA3 antibodies in new species:
Sequence homology analysis:
Compare the immunogen sequence across species using alignment tools
Higher homology (>80%) suggests potential cross-reactivity
Step-wise validation:
Start with Western blot to confirm band at expected molecular weight
Proceed to IHC/IF only after Western blot validation
Include known positive control tissue alongside test samples
Multiple antibody approach:
Test multiple antibodies targeting different epitopes
Concordant results increase confidence in cross-reactivity
Knockout/knockdown controls:
If available, include tissue from APBA3-deficient animals of the test species
Alternatively, use siRNA knockdown in cultured cells from the test species
As noted in a customer question to Bosterbio, while an antibody might not be validated for a specific species (e.g., goat), cross-reactivity is possible and can be tested through an innovator award program .
For investigating the APBA3-HIF-1 pathway:
Co-immunoprecipitation studies:
Use APBA3 antibodies to pull down protein complexes
Detect HIF-1α and FIH-1 (factor inhibiting HIF-1) in the immunoprecipitates
Compare results in normoxia vs. hypoxia
Chromatin immunoprecipitation (ChIP):
Analyze HIF-1 binding to target promoters in wild-type vs. APBA3-deficient cells
Focus on glycolytic enzyme genes and VEGFA promoter regions
Proximity ligation assay:
Detect protein-protein interactions between APBA3 and pathway components
Visualize interactions in situ in tissue sections
Disease model applications:
Compare APBA3 expression in inflammation models (e.g., LPS-induced sepsis)
Analyze expression in cancer metastasis models at different timepoints
Correlate with disease progression and outcomes
The APBA3-HIF-1 pathway can be therapeutically targeted, as APBA3 deficiency specifically affects macrophage function without impacting other cell types significantly .
When studying APBA3 in specific cell populations:
Cell isolation techniques:
For monocytes/macrophages, use CD115, CCR2, or Ly-6C as sorting markers
Flow cytometry can separate inflammatory from resident macrophages
Magnetic bead-based isolation provides higher cell yields
Conditional knockout approaches:
Use LysM-Cre for myeloid-specific APBA3 deletion
Compare with global APBA3 knockout to distinguish cell-autonomous effects
In vivo tracking:
Label isolated cells with fluorescent dyes before adoptive transfer
Use reporter mice (e.g., GFP under APBA3 promoter) to track expression
Single-cell analysis:
Combine APBA3 antibodies with additional markers for heterogeneity assessment
Consider single-cell RNA-seq to correlate APBA3 with global expression patterns
Research using myeloid-specific APBA3 knockout (LysM-Cre x APBA3-floxed) mice has confirmed that macrophage-specific APBA3 deletion recapitulates many aspects of global knockout phenotypes .
Understanding APBA3 modifications is crucial for antibody selection:
Post-translational modifications:
Phosphorylation can alter antibody recognition
Western blot analysis might reveal multiple bands reflecting modified forms
Treat samples with phosphatases to confirm modification status
Truncated variants:
APBA3-NT (amino acids 1-214) has been used in functional studies
Antibodies targeting different regions may yield varying results
Consider using antibodies against N-terminal, C-terminal, and internal regions
Domain-specific functions:
APBA3 contains protein-protein interaction domains
Antibodies targeting specific domains might interfere with function
Use epitope mapping to understand antibody binding sites
Experimental considerations:
For functional studies, ensure antibodies don't interfere with key interactions
For detection only, multiple antibodies can provide comprehensive coverage
Expression constructs for APBA3-NT and lentiviral vectors carrying APBA3 cDNA can be useful tools for functional validation .