ARPC5A Antibody

What is ARPC5 and what cellular functions does it regulate?

ARPC5 is a 16kDa subunit of the Arp2/3 complex that plays critical roles in actin polymerization dynamics. It exists in two isoforms, ARPC5 and ARPC5L, which differentially regulate cytoplasmic and nuclear actin polymerization processes. ARPC5 has a diffuse cytoplasmic distribution but is also detected as punctae in both the cytoplasm and nucleus, with additional localization at the plasma membrane that becomes particularly pronounced following surface-mediated T-cell receptor (TCR) engagement . Functionally, the Arp2/3 complex containing ARPC5 nucleates actin filaments at an angle from preexisting filaments, resulting in branched networks of polymerized actin that are essential for various cellular processes including cell migration, endocytosis, and immune cell function . Recent research has also identified ARPC5 as a potential prognostic biomarker in glioma, with high expression correlating with worse prognosis and unfavorable clinical characteristics .

What are the key differences between ARPC5 and ARPC5L isoforms?

ARPC5 and ARPC5L demonstrate distinct functional roles in actin polymerization dynamics:

• Subcellular distribution: Both isoforms show diffuse cytoplasmic distribution with punctate patterns in cytoplasm and nucleus, but their relative abundance varies between cellular compartments .

• Functional specialization: ARPC5L appears more critical for nuclear actin polymerization, while ARPC5 predominantly regulates cytoplasmic actin networks .

• Signaling pathway integration: Evidence suggests ARPC5L is regulated by calcium-calmodulin signaling in response to T cell activation .

• Immune function roles: Single-cell RNA sequencing revealed differential expression patterns, with ARPC5L expression increased in cytokine-expressing effector CD4 T cells relative to non-cytokine expressing cells, suggesting specific roles in shaping T cell identity and immune responses .

• Branch junction stability: Both isoforms have been reported to fine-tune nucleation activity and branch junction stability, but with differential potency .

What applications can ARPC5 antibodies be used for?

ARPC5 antibodies are versatile tools applicable across multiple research methodologies:

Researchers should select antibodies based on the specific application and epitope requirements. For example, antibodies targeting amino acids 1-154 of ARPC5 have been validated for ELISA and IHC applications with human samples , while antibodies targeting the N-terminal region have broader cross-reactivity across human, rat, and mouse samples .

How should I design experiments to differentiate between ARPC5 and ARPC5L functions?

To effectively distinguish between the functions of ARPC5 and ARPC5L isoforms:

• Gene silencing approach: Use isoform-specific knockdown or knockout models. CRISPR-Cas9 ribonucleoprotein transfection has been successfully employed to generate ARPC5 or ARPC5L knockout cell lines with at least 80% reduction in target protein levels . Guide RNA sequences such as GATATGACGAGAACAAGTTCG for mouse ARPC5 and GATTCGTAGACGAGCACGAAG for mouse ARPC5L have been validated for this purpose .

• Rescue experiments: Perform complementation studies by reintroducing wild-type or mutant versions of each isoform in knockout backgrounds. This approach confirms specificity and allows structure-function analyses. Expression of wild-type ARPC5 in ARPC5-deficient cells has been shown to restore protein expression and rescue functional defects .

• Subcellular localization: Use fluorescently-tagged constructs (e.g., mCherry-tagged ARPC5 and ARPC5L) to observe differential localization patterns during specific cellular processes like T-cell activation .

• Functional readouts: Assess distinct parameters that differentiate cytoplasmic from nuclear actin dynamics, such as:

  • Cell migration and invasion assays for cytoplasmic functions

  • Gene expression analysis for nuclear functions (e.g., cytokine production in T cells)

What controls are essential when using ARPC5 antibodies in immunoblotting?

When conducting immunoblotting experiments with ARPC5 antibodies, the following controls are critical:

• Knockout/knockdown validation: Include lysates from ARPC5-knockout cells to confirm antibody specificity. This is particularly important given the sequence similarity between ARPC5 isoforms .

• Loading controls: Use established housekeeping proteins such as GAPDH (1:10000 dilution) alongside ARPC5 (typically 1:600 dilution) .

• Protein complex integrity: When studying Arp2/3 complex composition, probe for multiple subunits to assess complex integrity. Studies have shown that ARPC5 deficiency affects levels of other subunits, particularly ARPC1A and ARPC1B .

• Recombinant protein standard: Include purified recombinant ARPC5 protein as a positive control and size reference.

• Sample preparation standardization: Extract total protein using RIPA buffer containing protease inhibitors and measure loading amounts with BCA assays. Separate proteins on 12% SDS-PAGE gels with approximately 20μg protein per lane .

How can I investigate the role of ARPC5 in T cell immune responses?

Investigating ARPC5's role in T cell immune responses requires multi-parameter analysis:

• Cytokine production assessment: Following knockdown of ARPC5 or ARPC5L in CD4 T cell lines (e.g., A3.01 cells), measure cytokine production (TNF-α, IL-2) in response to stimulation with PMA+Ionomycin. Research has shown that both ARPC5L and ARPC5 are required for full cytokine production .

• Nuclear actin dynamics visualization: Use established methods to visualize nuclear actin polymerization in response to T cell activation, correlating this with ARPC5 isoform expression. Microscopic analysis can be coupled with cytokine detection in the same cells to establish direct relationships .

• Single-cell analysis: Implement single-cell RNA sequencing to identify subpopulations of T cells with differential ARPC5 isoform expression. Studies have revealed that distinct subfractions of CD4 T cells express one isoform or the other, with the frequency of cells displaying nuclear actin polymerization matching that of ARPC5L-expressing cells .

• Calcium-calmodulin signaling connection: Investigate how calcium-calmodulin pathways differentially regulate ARPC5 isoforms during T cell activation, using calcium chelators or calmodulin inhibitors .

What methods can detect changes in Arp2/3 complex composition when ARPC5 is altered?

Detecting alterations in Arp2/3 complex composition following ARPC5 manipulation requires sophisticated biochemical approaches:

• Co-immunoprecipitation with subunit-specific antibodies: Pull down the complex using antibodies against stable subunits (ARPC2 or ARP3), then analyze the precipitation products for other components including both ARPC5 isoforms .

• Native gel electrophoresis: Use non-denaturing conditions to separate intact complexes, followed by western blotting to detect different subunits. This approach can reveal changes in complex electrophoretic mobility that reflect compositional differences .

• Proximity ligation assays: Detect in situ interactions between Arp2/3 subunits using antibody pairs and proximity-dependent DNA amplification, allowing visualization of complex integrity in specific subcellular locations.

• Mass spectrometry analysis: Perform quantitative proteomics on purified Arp2/3 complexes to determine precise stoichiometric changes in subunit composition following ARPC5 manipulation.

• Rescue experiments with mutant constructs: Transfect ARPC5-deficient cells with wild-type or mutant ARPC5 to determine regions critical for complex assembly. Studies have shown that wild-type ARPC5 expression in ARPC5-deficient cells restores not only ARPC5 levels but also increases ARPC1A and ARPC1B expression .

How does ARPC5 expression correlate with disease progression in cancer?

Recent research has identified significant correlations between ARPC5 expression and cancer progression:

• Prognostic biomarker potential: High ARPC5 expression correlates with worse prognosis in glioma patients. Analysis methods include:

  • Survival curve analysis stratified by ARPC5 expression levels

  • Correlation with unfavorable clinical characteristics

  • Gene Ontology (GO) and KEGG pathway analyses to identify associated signaling networks

• Immune microenvironment connections: ARPC5 expression strongly associates with:

  • Immune cell infiltration patterns

  • Tumor mutational burden (TMB)

  • Microsatellite instability (MSI)

  • Expression of immune biomarkers relevant to immunotherapy response

• Functional validation: Targeted knockout approaches have demonstrated that ARPC5 depletion significantly reduces the proliferation and invasion capacity of glioma cell lines (LN229 and U251), providing mechanistic insights into its role in cancer progression .

• Single-cell analysis: Single-cell approaches have revealed increased ARPC5 expression in specific cell populations within the tumor microenvironment, including astrocytes, monocytes, and T cells .

How can I improve detection specificity when both ARPC5 and ARPC5L are present?

Distinguishing between highly similar ARPC5 isoforms presents technical challenges that can be addressed through:

• Isoform-specific antibody validation: Test antibodies on samples with known expression patterns (e.g., ARPC5 or ARPC5L knockout samples). Currently available antibodies often do not discriminate between isoforms, necessitating complementary approaches .

• Genetic manipulation approaches: Use isoform-specific knockouts as reference standards and controls. Studies have generated both individual knockout lines and double-knockout lines for comprehensive analysis .

• RNA-level discrimination: Employ RT-qPCR with isoform-specific primers to distinguish and quantify mRNA levels of each isoform.

• Tagged protein expression: Introduce epitope-tagged versions of each isoform (e.g., mCherry-tagged ARPC5 and ARPC5L) for visualization and functional rescue experiments .

• Subcellular fractionation: Separately analyze nuclear and cytoplasmic fractions to leverage the differential distribution of the isoforms.

What factors might lead to inconsistent ARPC5 antibody staining in immunofluorescence studies?

Several factors can affect the consistency and specificity of ARPC5 immunofluorescence staining:

• Fixation method sensitivity: Optimize fixation conditions as ARPC5's detection can be sensitive to fixation method. Different fixatives (paraformaldehyde, methanol) may reveal different epitopes or structural states.

• Epitope masking in complex: ARPC5's incorporation into the Arp2/3 complex may mask epitopes, requiring optimization of antigen retrieval methods.

• Dynamic redistribution: ARPC5 shows redistribution during cellular processes such as T cell activation, with enhanced membrane localization following TCR engagement . Standardize activation states when comparing samples.

• Cross-reactivity: Antibodies may detect both ARPC5 isoforms. Validate specificity using isoform-specific knockout samples.

• Cellular heterogeneity: Single-cell analysis has shown that distinct subfractions of cells express different ARPC5 isoform patterns . This natural heterogeneity requires careful population analysis rather than assessment of individual cells.

How can I investigate the relationship between ARPC5 deficiency and immune dysregulation?

Recent discoveries linking ARPC5 to immune disorders provide a foundation for investigation:

• Patient-derived sample analysis: Study PBMC, T-cell blasts, and fibroblasts from patients with ARPC5 mutations to assess protein expression, Arp2/3 complex formation, and functional defects .

• Cytokine dysregulation focus: Particularly examine IL-6-mediated signaling pathways, which have been implicated in ARPC5 deficiency. This provides potential therapeutic targets for treating ARPC5-related immunodeficiency .

• Comparative analysis with related disorders: Compare phenotypic and molecular features of ARPC5 deficiency with other actinopathies, particularly ARPC1B deficiency. Research has shown that ARPC5 deficiency affects ARPC1B levels, but ARPC1B deficiency does not affect ARPC5 expression .

• Rescue experiments: Test whether wild-type ARPC5 expression can restore immune cell function in patient-derived cells. Such experiments have confirmed that expression of wild-type ARPC5 recovers ARPC5 protein expression and increases ARPC1A and ARPC1B levels .

• Mouse models: Develop conditional knockout models to study tissue-specific effects of ARPC5 deficiency on immune cell development and function.

What novel approaches can differentiate the structural and functional impacts of ARPC5 isoforms on Arp2/3 complex activity?

Advanced methodologies to distinguish ARPC5 isoform contributions include:

• In vitro reconstitution: Assemble Arp2/3 complexes with either ARPC5 or ARPC5L to directly compare their nucleation activity and branch stability using purified components and fluorescence microscopy-based actin polymerization assays.

• Structure-function analysis: Generate chimeric constructs swapping domains between ARPC5 and ARPC5L to identify regions responsible for their functional differences in nucleation activity and branch junction stability .

• Super-resolution microscopy: Employ techniques such as STORM or PALM to visualize branched actin networks at nanoscale resolution in cells expressing different ARPC5 isoforms.

• CRISPR-based screening: Perform genome-wide CRISPR screens in ARPC5 or ARPC5L knockout backgrounds to identify genetic interactions and compensatory mechanisms specific to each isoform.

• Signaling pathway integration: Investigate how upstream signaling events (particularly calcium-calmodulin pathways) differentially regulate complex assembly and activation depending on ARPC5 isoform incorporation .