axin2 Antibody

What is AXIN2 and what is its role in cellular signaling pathways?

AXIN2, also known as Conductin or Axil, is a multidomain scaffold protein that functions as a negative regulator of Wnt signaling. It directly interacts with beta-catenin and GSK3B, playing a crucial role in the degradation complex that controls beta-catenin levels. AXIN2 contains multiple phosphorylation sites and can undergo poly(ADP-ribosyl)ation by tankyrase proteins TNKS and TNKS2. This post-translational modification leads to ubiquitination by RNF146, resulting in AXIN2 degradation and subsequent activation of Wnt signaling. Unlike its constitutively expressed homolog AXIN1, AXIN2 is primarily localized in the cytoplasm, and mutations in this protein have been implicated in colorectal cancer development .

What are the key differences between AXIN1 and AXIN2 antibodies in experimental applications?

While both AXIN1 and AXIN2 are components of the beta-catenin destruction complex, they display distinct experimental characteristics when detected with their respective antibodies. Recent research has revealed that AXIN2 can promote the degradation of AXIN1 through tankyrase-mediated mechanisms, which has significant implications for experimental design . When using antibodies against these proteins, researchers should be aware that AXIN2 typically appears at approximately 94-100 kDa on Western blots, while AXIN1 may show different migration patterns . Additionally, knockout validation experiments demonstrate that AXIN2 antibodies like the rabbit polyclonal (20540-1-AP) and Cell Signaling's 76G6 rabbit monoclonal show high specificity with minimal cross-reactivity to AXIN1, making them suitable for differential studies of these paralogous proteins .

What are the common applications of AXIN2 antibodies in research settings?

AXIN2 antibodies are versatile tools in molecular biology research with several well-established applications. Based on published literature, Western blotting (WB) is the most frequently utilized technique, with over 46 publications documenting successful implementation . Immunohistochemistry (IHC) has been validated in at least 4 publications, while immunofluorescence (IF) applications appear in 3 publications . Immunoprecipitation (IP) studies have also been documented, though less frequently. The antibodies are additionally suitable for ELISA techniques. Notably, these antibodies have been employed in knockdown/knockout validation studies, providing critical tools for confirming gene editing experiments in cell lines like SW480 where CRISPR/Cas9 was used to generate AXIN2 knockout models .

What are the optimal dilutions for AXIN2 antibody in different experimental applications?

The optimal dilution of AXIN2 antibodies varies significantly depending on the specific application and the antibody being used. For Western blotting (WB), the polyclonal antibody 20540-1-AP from Proteintech is recommended at dilutions ranging from 1:1000 to 1:4000, while Cell Signaling's 76G6 rabbit monoclonal antibody is effective at 1:1000 . For immunoprecipitation applications, a higher concentration is typically required, with the 76G6 antibody recommended at 1:50 dilution . While specific dilutions for immunohistochemistry (IHC) and immunofluorescence (IF) vary between manufacturers, published research has successfully employed concentrations ranging from 5-20 μg/ml for IHC applications with ab107613 . It is important to note that these dilutions should be considered starting points, and researchers are advised to titrate the antibody in their specific testing systems to obtain optimal results, as reactivity can be sample-dependent .

Which cell lines and tissue samples provide reliable positive controls for AXIN2 antibody validation?

Several cell lines have been documented as reliable positive controls for AXIN2 antibody validation in Western blotting applications. According to product validation data, A549 (lung carcinoma), MDA-MB-453s (breast cancer), BxPC-3 (pancreatic cancer), and HeLa cells all express detectable levels of endogenous AXIN2 protein . For tissue samples, mouse lung and colon tissues have been successfully used for immunohistochemical detection of AXIN2, showing distinct expression patterns that serve as excellent positive controls . The SW480 colorectal cancer cell line is particularly notable, as it has been used to generate CRISPR/Cas9 AXIN2 knockout models, providing paired positive and negative controls that are invaluable for antibody validation . These knockout cells can be screened for loss of AXIN2 expression via Western blotting against AXIN2 (with α-tubulin as loading control), offering a definitive system for confirming antibody specificity .

What sample preparation techniques are recommended for optimal AXIN2 detection?

Effective sample preparation is critical for successful AXIN2 detection across various experimental techniques. For Western blotting, cellular proteins are typically extracted in standard lysis buffers containing protease inhibitors to prevent degradation of AXIN2, which has an observed molecular weight of 94-100 kDa . When performing immunohistochemistry on formalin-fixed paraffin-embedded (FFPE) tissue sections, antigen retrieval through heat mediation in citrate buffer is crucial for recovering AXIN2 epitopes that may be masked during fixation . For immunofluorescence studies, methanol fixation followed by permeabilization with 0.5% Triton X-100 has been successfully employed in U2OS cells expressing tagged AXIN2 constructs . Additionally, blocking with appropriate serum (typically 10%) for approximately 60 minutes at room temperature (25°C) helps reduce background and enhance specific signal detection . When using antibodies against endogenous AXIN2, validation through knockdown or knockout experiments is highly recommended to confirm signal specificity .

How can AXIN2 antibodies be employed to investigate Wnt signaling pathway dynamics?

AXIN2 antibodies serve as essential tools for investigating Wnt signaling dynamics due to AXIN2's role as both a negative regulator and a transcriptional target of the pathway. For studying pathway activation, researchers can monitor AXIN2 protein levels alongside beta-catenin, as the two proteins directly interact in the destruction complex . When employing co-immunoprecipitation approaches, specific antibodies like Cell Signaling's 76G6 (at 1:50 dilution) can effectively pull down AXIN2 along with its binding partners to analyze complex formation and modification . The relationship between AXIN1 and AXIN2 presents a particularly interesting area for investigation, as recent research has demonstrated that AXIN2 can promote tankyrase-mediated degradation of AXIN1, representing a novel regulatory mechanism within the Wnt pathway . For in-depth spatiotemporal analysis, researchers can combine AXIN2 immunofluorescence with other Wnt pathway components, incorporating AXIN2 antibodies into multiplexed imaging protocols to visualize pathway dynamics in both fixed and live cell systems .

What considerations are important when using AXIN2 antibodies in CRISPR/Cas9 knockout validation studies?

When validating CRISPR/Cas9-mediated AXIN2 knockouts, several critical considerations ensure reliable results. First, selecting an antibody targeting an epitope within or near the edited region is essential for confirming gene disruption—antibodies like 20540-1-AP (recognizing an AXIN2 fusion protein) or 76G6 from Cell Signaling are well-documented choices for this purpose . Researchers should implement proper experimental controls, including wild-type cells processed in parallel with knockout candidates and sequence verification of the targeted locus. As demonstrated in the SW480 cell line knockout protocol, guide RNA sequences targeting the first coding exon (e.g., CGAGATCCAGTCGGTGATGG) can be effective for generating complete AXIN2 knockouts . For verification, Western blotting against AXIN2 with appropriate loading controls (α-tubulin) provides initial confirmation, while sequencing of the targeted region offers definitive validation of successful editing . Additionally, phenotypic assessment of Wnt pathway activity (through β-catenin levels or downstream target expression) provides functional validation of the knockout effect .

What are the methodological approaches for studying AXIN2 and its interaction partners using antibody-based techniques?

Studying AXIN2 interactions requires sophisticated antibody-based methodologies tailored to specific research questions. Co-immunoprecipitation (co-IP) represents a foundational approach, with antibodies like Cell Signaling's 76G6 effectively pulling down AXIN2 complexes . When investigating novel binding partners, researchers often employ a combination of tagged constructs (GFP-AXIN2, Flag-AXIN2, or HA-AXIN2) alongside antibodies against endogenous proteins . For studying AXIN2's role in promoting TNKS-mediated degradation of AXIN1, experimental designs frequently incorporate transiently expressed proteins with various tags, allowing researchers to distinguish between the paralogous proteins . In advanced approaches, proximity ligation assays using specific AXIN2 antibodies can visualize protein-protein interactions in situ with subcellular resolution. Importantly, validation through siRNA-mediated knockdown (using sequences such as 5′-GAGAUGGCAUCAAGAAGCA-3′ for human AXIN2) helps confirm the specificity of detected interactions . When analyzing complexes containing both AXIN1 and AXIN2, researchers must carefully select antibodies with minimal cross-reactivity between these structurally similar proteins .

Why might researchers observe multiple bands when probing for AXIN2 in Western blots?

Multiple bands when probing for AXIN2 in Western blots can result from several biological and technical factors. First, post-translational modifications of AXIN2, particularly its numerous phosphorylation sites and poly(ADP-ribosyl)ation by tankyrase proteins (TNKS and TNKS2), can cause mobility shifts that appear as distinct bands . The observed molecular weight of AXIN2 typically ranges from 94-100 kDa, but modified forms may migrate differently . Additionally, AXIN2 can undergo ubiquitination by RNF146 as part of its regulated degradation within the Wnt signaling pathway, potentially generating additional bands representing ubiquitinated species . Alternative splicing of AXIN2 transcripts may produce variant protein isoforms with different molecular weights. From a technical perspective, proteolytic degradation during sample preparation can generate fragments that appear as lower molecular weight bands, emphasizing the importance of using fresh samples with appropriate protease inhibitors . When interpreting multiple bands, researchers should validate specificity through knockdown/knockout controls and consider complementary approaches like mass spectrometry to identify the nature of each band .

What strategies can minimize background and non-specific binding in AXIN2 immunohistochemistry and immunofluorescence?

Achieving clean, specific staining in AXIN2 immunohistochemistry (IHC) and immunofluorescence (IF) requires several optimization strategies. Effective antigen retrieval is critical—for FFPE tissues, heat-mediated retrieval in citrate buffer has proven successful in recovering AXIN2 epitopes . Thorough blocking is essential, with protocols showing good results using 10% serum for 60 minutes at 25°C before primary antibody application . Optimizing antibody dilution is crucial; while published studies have used concentrations of 5-20 μg/ml for IHC with ab107613, each experimental system may require specific titration . Incubation conditions significantly impact signal-to-noise ratios, with extended incubation at 4°C (e.g., 18 hours) often producing better results than shorter incubations at higher temperatures . When performing IF, methanol fixation followed by 0.5% Triton X-100 permeabilization has been effective for AXIN2 detection in cellular models . For particularly challenging samples, using monoclonal antibodies like Cell Signaling's 76G6 may offer improved specificity compared to polyclonal alternatives . Finally, implementing appropriate negative controls, including knockout/knockdown samples or isotype controls, helps distinguish true signal from background .

How should researchers interpret changes in AXIN2 expression patterns in disease models and clinical samples?

Interpreting changes in AXIN2 expression in disease models requires careful consideration of multiple factors. As a negative regulator and target gene of Wnt signaling, AXIN2 levels often reflect pathway activation status—increased expression may indicate active canonical Wnt signaling . In colorectal cancer models, where AXIN2 mutations have been implicated in pathogenesis, altered expression patterns may represent compensatory mechanisms or loss of regulatory function . When analyzing tissue samples through IHC, researchers should assess both expression intensity and localization patterns, comparing with appropriate control tissues as demonstrated in studies of mouse lung and colon specimens . Quantitative Western blot analysis provides more precise measurement of expression changes, with the 94-100 kDa band representing the full-length protein . Changes in AXIN2 should be interpreted in the context of other Wnt pathway components, particularly β-catenin levels and localization . For clinical samples, correlation with patient data and disease progression metrics enhances interpretative value. Additionally, genetic analysis of the AXIN2 locus can provide context for expression changes, especially in cases where mutations might affect protein stability or function rather than expression levels .

How do monoclonal and polyclonal AXIN2 antibodies compare in research applications?

Monoclonal and polyclonal AXIN2 antibodies offer distinct advantages depending on the specific research application. Monoclonal antibodies like Cell Signaling's 76G6 Rabbit mAb provide superior specificity and consistency between lots, making them particularly valuable for quantitative applications and longitudinal studies . These antibodies recognize a single epitope, reducing non-specific binding and background in techniques like Western blotting (recommended at 1:1000 dilution) and immunoprecipitation (effective at 1:50 dilution) . Conversely, polyclonal antibodies such as Proteintech's 20540-1-AP recognize multiple epitopes on the AXIN2 protein, potentially offering enhanced sensitivity for detecting low-abundance proteins or partially denatured epitopes . This polyclonal approach proves beneficial in applications like immunohistochemistry, where antigen availability may be limited due to fixation procedures . For Western blotting applications, polyclonal antibodies typically require optimization within a broader dilution range (1:1000-1:4000) . When selecting between these antibody types, researchers should consider factors including the specific application, required sensitivity, and the importance of lot-to-lot consistency for their experimental timeline .

What methodological considerations are important when studying both AXIN1 and AXIN2 simultaneously?

Simultaneous investigation of AXIN1 and AXIN2 presents unique methodological challenges due to their structural similarities and functional interrelationship. Recent research has revealed that AXIN2 can promote TNKS-mediated degradation of AXIN1, highlighting the complex regulatory relationship between these proteins . When designing experiments to study both proteins, antibody selection becomes crucial—researchers should verify minimal cross-reactivity between AXIN1 and AXIN2 antibodies through knockout validation . For Western blotting applications, the slightly different molecular weights (AXIN1 at approximately 93 kDa and AXIN2 at 94-100 kDa) may allow simultaneous detection on the same membrane with careful exposure management . In co-immunoprecipitation studies, epitope tag systems (such as GFP-AXIN1, Flag-AXIN2, or HA-AXIN2) can help distinguish between the paralogous proteins, as demonstrated in studies of their interaction with tankyrase . For genetic manipulation experiments, specific siRNA sequences targeting human AXIN2 (such as 5′-GAGAUGGCAUCAAGAAGCA-3′) have been validated for selective knockdown without affecting AXIN1 expression . Additionally, CRISPR/Cas9 approaches targeting unique regions of each gene can generate selective knockout models for studying their individual contributions to Wnt signaling .

What are the emerging applications of AXIN2 antibodies in cancer research and developmental biology?

AXIN2 antibodies are increasingly applied in cutting-edge cancer research and developmental biology studies. In cancer research, these antibodies help elucidate the mechanistic relationship between Wnt signaling dysregulation and tumor progression, particularly in colorectal cancers where AXIN2 mutations have been implicated . Recent methodological advances include using AXIN2 antibodies in multiplexed imaging approaches to simultaneously visualize multiple components of the Wnt pathway within tumor microenvironments . The generation of CRISPR/Cas9 AXIN2 knockout cell lines, validated using specific antibodies, has created valuable model systems for investigating how AXIN2 loss affects cancer phenotypes and treatment responses . In developmental biology, AXIN2 antibodies facilitate tracking of spatiotemporal Wnt signaling dynamics during embryogenesis and tissue morphogenesis. Additionally, the recently discovered regulatory relationship between AXIN2 and AXIN1 through tankyrase-mediated degradation represents a novel mechanism potentially targetable in therapeutic development . For such applications, researchers increasingly combine traditional antibody-based techniques with advanced approaches like proximity ligation assays, FRET-based interaction studies, and high-content imaging to achieve more comprehensive understanding of AXIN2's multifaceted roles .