BANF1 Antibody

What is BANF1 and why are antibodies against it important in research?

BANF1 is a small (10 kDa) DNA-binding protein that functions as a dimer and non-specifically binds to the phosphate backbone of double-stranded DNA . It plays crucial roles in:

• Maintaining nuclear envelope integrity

• Proper chromatin organization

• Interacting with nuclear proteins (LAP2, emerin, MAN1)

• Acting as a component of retroviral pre-integration complexes (PICs)

BANF1 antibodies are essential tools for studying these diverse functions across multiple research applications including Western blotting, immunofluorescence, and immunohistochemistry, allowing researchers to examine BANF1 expression, localization, and interaction with other proteins .

What are the recommended dilutions and applications for BANF1 antibodies?

Based on validated protocols, optimal dilutions vary by application:

It's critical to note that these dilutions should be titrated for each specific experimental system to obtain optimal results. Sample-dependent factors may influence antibody performance . Additionally, positive controls have been validated in several cell lines:

• For WB: HeLa cells, NIH/3T3 cells

• For IF/ICC: HepG2 cells, 293T cells

How should BANF1 antibodies be stored to maintain reactivity?

For optimal performance and stability:

• Store BANF1 antibodies at -20°C in their recommended buffer (typically PBS with 0.02% sodium azide and 50% glycerol at pH 7.3)

• Antibodies are generally stable for one year after shipment when properly stored

• For small volume antibodies (20μl), aliquoting is unnecessary for -20°C storage

• Some formulations contain 0.1% BSA as a stabilizer

Proper storage conditions are essential as degraded antibodies can lead to inconsistent results and false negatives in experimental settings.

What molecular weight should be detected when using BANF1 antibodies?

When performing Western blot analysis:

This discrepancy between calculated and observed molecular weights is important to note when validating antibody specificity. The difference may be attributed to post-translational modifications or the biochemical properties of the protein.

How can BANF1 antibodies be utilized to study cancer progression and prognosis?

BANF1 has emerged as a potential prognostic biomarker in multiple cancers, particularly head and neck squamous cell carcinoma (HNSCC). Methodological approach:

• Immunohistochemical analysis: Use BANF1 antibodies (1:100 dilution) on tissue microarrays to evaluate expression differences between tumor and adjacent normal tissues

• Correlation with clinical data:

  • BANF1 is markedly overexpressed in 15 tumor types including COAD, LUAD, LIHC, and HNSCC

  • High expression correlates with poor survival outcomes

• Quantitative assessment:

  • Extract BANF1 gene expression data from each sample

  • Calculate stromal and immune scores using the ESTIMATE algorithm

  • Analyze correlation between BANF1 expression and immune cell infiltration using Pearson's correlation

Research has shown that BANF1 expression is negatively correlated with immune cell infiltration in 15 of 33 TCGA cancer types, making it a valuable target for prognostic studies .

What methods should be employed to investigate BANF1's role in antitumor immunity?

To study BANF1's role in cancer immunity:

• Knockout experiments using CRISPR/Cas9:

  • Target murine Banf1 using validated sgRNA sequences (e.g., #2: ATGAAGACCTCTTCCGAGAA; #4: AAAGCAGTCCCGGGACTGCT)

  • Select cells by puromycin resistance and confirm knockout by Western blot

• Immune cell infiltration analysis:

  • Use flow cytometry to evaluate changes in tumor-infiltrating immune cells (especially CD8+ T cells)

  • Perform immunofluorescence to visualize spatial distribution of immune cells in the tumor microenvironment

• Mechanistic studies:

  • Investigate activation of the cGAS-STING pathway through RNA sequencing

  • Examine interferon signaling pathways activated upon BANF1 depletion

Research has demonstrated that BANF1 deficiency in tumor cells markedly antagonizes tumor growth in immunocompetent but not immunocompromised mice, suggesting an immune-dependent mechanism .

How can researchers investigate the relationship between BANF1 and immune checkpoint inhibitor therapy?

To explore BANF1's impact on immunotherapy response:

• Tumor Immune Dysfunction and Exclusion (TIDE) analysis:

  • Calculate TIDE scores for tumors with high vs. low BANF1 expression

  • Higher TIDE scores in low BANF1 expression groups indicate potential resistance to immune checkpoint inhibitors

• Combination therapy experiments:

  • Use BANF1 knockout cell lines in combination with anti-PD-1 antibodies

  • Monitor tumor growth in immunocompetent mouse models (e.g., MC38 or B16F10)

• Analysis of clinical cohorts:

  • Stratify patient data from immunotherapy clinical trials based on BANF1 expression

  • Correlate expression levels with response rates and survival outcomes

Research findings indicate that combining BANF1 knockout with anti-PD-1 therapy provides enhanced therapeutic benefit compared to anti-PD-1 alone, suggesting BANF1 targeting as a potential strategy for improving immunotherapy efficacy .

What are the best practices for optimizing Western blot protocols with BANF1 antibodies?

For optimal Western blot results:

• Sample preparation:

  • Use established cell lines with confirmed BANF1 expression (HeLa, NIH/3T3)

  • Extract proteins using buffers that preserve nuclear proteins

• Gel selection and transfer:

  • Use higher percentage gels (15-18%) for optimal resolution of the small BANF1 protein (14 kDa)

  • Employ lower molecular weight markers to accurately track migration

• Antibody incubation:

  • Start with a mid-range dilution (1:1000) and optimize as needed

  • Include proper positive controls (HeLa or NIH/3T3 cell lysates)

• Detection optimization:

  • Use enhanced chemiluminescence with longer exposure times if signal is weak

  • Consider signal amplification methods for low-abundance samples

What strategies can be employed to analyze rare BANF1 variants in research settings?

For studying rare BANF1 variants:

• In silico modeling:

  • Predict structural changes using molecular modeling software

  • Assess potential impacts on protein-protein interactions and DNA binding

• Biophysical approaches:

  • Employ circular dichroism to analyze secondary structure changes

  • Use thermal shift assays to assess protein stability

  • Conduct DNA binding assays to determine functional impacts

• Cell-based assays:

  • Develop cell models expressing variant forms of BANF1

  • Analyze effects on nuclear envelope integrity and chromatin organization

  • Examine localization patterns using immunofluorescence

Research has demonstrated that while rare variants may not significantly alter the secondary structure of BANF1, several single amino acid variants in the N- and C-terminus can impact DNA binding ability without altering BANF1 localization or nuclear integrity .

How can researchers effectively use single-cell sequencing approaches to study BANF1 expression?

To leverage single-cell RNA sequencing for BANF1 research:

• Dataset selection and analysis:

  • Utilize established HNSCC single-cell sequencing datasets (e.g., GSE103322, GSE139324, GSE172577)

  • Access these through the TISCH database for analysis

• Cell type-specific expression analysis:

  • Identify cell populations with differential BANF1 expression

  • Correlate with markers of specific immune cell subsets

• Trajectory analysis:

  • Examine changes in BANF1 expression during cellular differentiation or tumor progression

  • Identify potential regulatory relationships with other genes

• Integration with spatial transcriptomics:

  • Combine single-cell data with spatial information to understand BANF1 expression in the context of tissue architecture

This approach enables researchers to understand the heterogeneity of BANF1 expression at the single-cell level and its relationship to specific cell populations within the tumor microenvironment .

How might BANF1 be exploited as a therapeutic target in cancer immunotherapy?

Based on recent findings:

• Targeting strategies:

  • Develop small molecule inhibitors of BANF1

  • Use siRNA or antisense oligonucleotides for transient BANF1 downregulation

  • Explore PROTAC technology for targeted BANF1 degradation

• Combination approaches:

  • Pair BANF1 inhibition with immune checkpoint blockade (anti-PD-1/PD-L1)

  • Investigate synergy with STING agonists to enhance immune activation

• Biomarker-guided therapy:

  • Stratify patients based on BANF1 expression levels

  • Select appropriate patients for BANF1-targeted combination therapy

Recent studies demonstrate that BANF1 knockout activates antitumor immune responses mediated by the cGAS-STING pathway, resulting in increased CD8+ T cell infiltration and decreased myeloid-derived suppressor cell enrichment .

What are the implications of BANF1's role in nuclear envelope integrity for understanding aging and disease?

BANF1's association with premature aging syndromes offers insights into fundamental biological processes:

• Studying BANF1 in aging models:

  • Use BANF1 antibodies to examine expression and localization changes with age

  • Investigate protein-protein interactions that may be disrupted

• Analysis of Néstor-Guillermo Progeria Syndrome (NGPS) mutations:

  • Compare wild-type and mutant BANF1 using structural and functional assays

  • Examine downstream effects on nuclear lamina organization and chromatin structure

• Therapeutic implications:

  • Identify compounds that might stabilize mutant BANF1

  • Explore approaches to modulate BANF1-dependent pathways in age-related diseases

Understanding BANF1's role in maintaining nuclear envelope integrity provides critical insights into the mechanisms of normal and premature aging, potentially informing therapeutic strategies for age-related disorders .

How can BANF1 antibodies be effectively used in multiparametric flow cytometry?

For complex flow cytometry panels:

• Panel design:

  • Combine anti-BANF1 with antibodies against other nuclear proteins

  • Include markers for cell cycle analysis (Ki-67, PCNA)

  • Select fluorophores with minimal spectral overlap

• Sample preparation:

  • Optimize fixation and permeabilization for nuclear protein detection

  • Use specialized nuclear permeabilization buffers

  • Consider sequential staining approaches for surface and nuclear markers

• Controls and validation:

  • Include BANF1 knockout or knockdown samples as negative controls

  • Use established cell lines with known BANF1 expression patterns

  • Validate flow cytometry results with complementary techniques (Western blot, IF)

This approach allows for quantitative assessment of BANF1 expression in heterogeneous cell populations and correlation with other cellular parameters.

What methodologies are recommended for studying BANF1's interactions with the cGAS-STING pathway?

To investigate this critical pathway:

• Genetic manipulation approaches:

  • Generate dual knockout models (BANF1/cGAS or BANF1/STING)

  • Use the established sgRNA sequences for cGAS and STING knockout:

    • For cGAS KO: target-specific sequences in the cGAS gene

    • For STING KO: target-specific sequences in the STING gene

• Mechanistic studies:

  • Measure cGAMP production using mass spectrometry

  • Assess STING activation through phosphorylation status

  • Monitor downstream interferon signaling using reporter assays

• Co-localization experiments:

  • Use BANF1 antibodies in combination with cGAS antibodies for co-immunoprecipitation

  • Perform proximity ligation assays to detect protein-protein interactions

  • Use confocal microscopy to visualize spatial relationships between proteins