Bartonella 17kDa

What is the molecular structure of the Bartonella henselae 17-kDa antigen?

The 17-kDa antigen of Bartonella henselae is a protein coded by an open reading frame of 148 amino acids with a predicted molecular mass of 16,893 Da . The amino terminus of the deduced amino acid sequence is hydrophobic in nature and similar in size and composition to signal peptides found in gram-negative bacteria . The remainder of the deduced amino acid sequence is more hydrophilic and likely represents surface-exposed epitopes that are immunologically significant . This structural arrangement suggests the protein may be secreted or membrane-associated, which would explain its immunological prominence during infection.

How conserved is the 17-kDa antigen across different Bartonella species?

The 17-kDa antigen gene has been identified in multiple Bartonella species including B. henselae, B. quintana, B. elizabethae, B. clarridgeiae, B. vinsonii subsp. vinsonii, and B. vinsonii subsp. berkhoffii . DNA sequencing revealed open reading frames capable of coding for proteins with similar sizes across these species, but with significant sequence divergence . Notably, despite extensive efforts using multiple primer pairs, no evidence of a B. bacilliformis homolog of the 17-kDa antigen gene was found . The molecular masses of the 17-kDa antigen homologs range from 16.9 kDa in B. henselae, B. quintana, and B. clarridgeiae to 26.2 kDa in B. vinsonii subsp. vinsonii .

What is the significance of amino acid sequence variation in the 17-kDa antigen?

The extensive sequence divergence across the Bartonella genus has important implications for both diagnosis and taxonomy . Particularly striking is the difference between the two subspecies of B. vinsonii, which show 45.6% sequence divergence in the 17-kDa antigen, suggesting either a more remote relationship than previously thought or genetic exchange that has accelerated evolutionary divergence . This sequence variation affects immunological cross-reactivity and could be utilized for developing species-specific diagnostic assays . The regions of conservation and variation provide insights into essential functional domains versus potentially adaptive regions of the protein.

What PCR methods are most effective for amplifying the 17-kDa antigen gene from different Bartonella species?

Multiple primer pair combinations have been developed for amplifying the 17-kDa antigen gene from various Bartonella species, with specific primer pairs optimized for each species . For instance, B. clarridgeiae is effectively amplified with primer pair 17KAF (5′ GGAATGAATGATGAGATCGC 3′) and 17KBR (5′ GTTGAGAAGACTATTCATCG-3′), while B. quintana and B. henselae are amplified with primer pair 240 (5′ GCTCTAGACAGGGACAAAGTTCCGTTGTTGC 3′) and 241 (5′-CGGGGTACCGCCATTGTCGTCACAATGACG 3′) . Additionally, highly conserved sequences internal to the 17-kDa antigen gene, using primers IntF (5′ GAAAAAATATAGCTTAGTCAC 3′) and IntR (5′CTAAAGTCGGACATCAGATT 3′), can confirm the presence of a homolog in most Bartonella species except B. bacilliformis .

How can the 17-kDa antigen be expressed as a recombinant protein for research purposes?

The 17-kDa antigen can be expressed as a recombinant protein through several approaches. One successful method involves PCR amplification of the gene with primers containing restriction enzyme sites (e.g., XbaI and BamHI) for directional cloning . The amplicon is then digested and ligated into an expression vector such as pUC19, positioning the gene downstream of an inducible promoter like the lacZ α-peptide promoter . Alternatively, the 17-kDa antigen has been successfully subcloned as a biotinylated fusion protein in the expression vector PinPoint Xa-2, resulting in a 30-kDa protein that maintains strong immunoreactivity with CSD patient sera . Amplification conditions typically involve initial denaturation at 94°C for 4 min, followed by specific cycling parameters optimized for the target species .

What are the key considerations when designing primers for 17-kDa antigen gene amplification?

When designing primers for the 17-kDa antigen gene, researchers should consider several factors: (1) The significant sequence divergence across Bartonella species necessitates species-specific primer design or targeting of conserved regions ; (2) For cloning purposes, incorporating restriction enzyme sites into primers facilitates directional insertion into expression vectors ; (3) Primer design should account for the hydrophobic N-terminal region versus the more hydrophilic remainder of the protein, which may affect PCR efficiency ; (4) For universal detection across most Bartonella species (except B. bacilliformis), primers targeting the most highly conserved coding regions (like IntF and IntR) are most effective ; (5) Optimization of amplification conditions, including annealing temperatures, is crucial due to varying GC content across species .

How does the 17-kDa antigen perform as a diagnostic marker compared to other serological methods?

The recombinant 17-kDa antigen demonstrates excellent performance as a diagnostic marker for Bartonella infections. In Western blot format, a recombinant fusion protein derived from the B. henselae 17-kDa antigen shows strong correlation with indirect fluorescent-antibody (IFA) assay results and clinical diagnosis of CSD . Specifically, the agreement between reactivity with the 30-kDa fusion protein on immunoblot analysis and IFA assay results was 92% for IFA-positive sera and 88% for IFA-negative sera . This high concordance suggests the recombinant 17-kDa antigen could provide a more standardized diagnostic reagent than whole-cell preparations, potentially addressing the variable sensitivities observed with IFA testing in different laboratories .

What explains the differences in cross-reactivity observed with human versus rabbit sera?

An intriguing aspect of the 17-kDa antigen's immunology is the difference in cross-reactivity patterns observed with human versus rabbit sera. Immunoblot analysis using human sera from CSD cases demonstrated very little cross-reactivity among different Bartonella species for this protein . In contrast, immunoblots using rabbit serum raised to the recombinant B. henselae antigen showed extensive cross-reactivity with the proteins of other Bartonella species . This discrepancy likely reflects differences in immune response between natural human infection (where exposure is to a single species and specific epitopes are recognized) versus experimental rabbit immunization (where high-dose exposure to the purified protein may generate antibodies against more conserved epitopes) . This phenomenon has important implications for both diagnostic test development and understanding the immunobiology of Bartonella infections.

How can researchers address species-specificity challenges in Bartonella diagnostics using the 17-kDa antigen?

Researchers can leverage the sequence divergence in the 17-kDa antigen to develop more species-specific diagnostic assays . Key approaches include: (1) Utilizing species-specific epitopes identified through epitope mapping of the 17-kDa antigen from different Bartonella species; (2) Developing multiplex assays that incorporate recombinant 17-kDa antigens from multiple species; (3) Employing differential diagnosis algorithms based on reactivity patterns with various 17-kDa antigen homologs; (4) Combining serological testing using the 17-kDa antigen with molecular methods like PCR amplification of species-specific regions of the 17-kDa antigen gene ; (5) Creating chimeric proteins containing species-specific epitopes for improved differential diagnosis. The limited cross-reactivity observed with human sera suggests that recombinant 17-kDa antigens could effectively differentiate infections caused by different Bartonella species .

What is the potential role of the 17-kDa antigen in Bartonella pathogenesis?

Although the exact function of the 17-kDa antigen in Bartonella pathogenesis remains to be fully elucidated, several characteristics suggest potential roles: (1) The hydrophobic N-terminal region resembling a signal peptide indicates the protein may be secreted or membrane-associated, potentially involved in host-pathogen interactions ; (2) The hydrophilic regions may represent surface-exposed epitopes that interact with host immune components ; (3) The strong immunogenicity of the protein suggests it may be abundantly expressed during infection or particularly accessible to the immune system ; (4) The conservation of the gene across multiple pathogenic Bartonella species (except B. bacilliformis) implies functional importance in the life cycle of these bacteria ; (5) The protein's apparent absence in B. bacilliformis may relate to the distinct pathogenic mechanisms of this species, which causes both vasoproliferative and hemolytic manifestations unlike other Bartonella species .

What methodological approaches can resolve contradictions in cross-reactivity data observed across different studies?

To address contradictions in cross-reactivity data for the 17-kDa antigen, researchers should consider: (1) Standardizing recombinant protein expression systems to ensure consistent protein folding and epitope presentation across studies ; (2) Employing epitope mapping techniques to identify which regions of the protein are recognized by antibodies from different sources (human patients versus experimental animals) and infections with different Bartonella species ; (3) Utilizing both Western blot and ELISA methodologies with purified recombinant proteins to quantitatively assess cross-reactivity ; (4) Developing peptide arrays covering the entire sequence of 17-kDa antigens from multiple species to pinpoint species-specific versus conserved epitopes ; (5) Implementing standardized serum panels with confirmed species-specific infections to evaluate diagnostic specificity; (6) Conducting prospective studies with molecular confirmation of infecting species to correlate with serological findings .

What does the molecular mass variation across Bartonella species reveal about the evolution of the 17-kDa antigen?

The molecular mass variation of the 17-kDa antigen across Bartonella species offers insights into evolutionary processes. The protein ranges from 16.9 kDa in B. henselae, B. quintana, and B. clarridgeiae to 26.2 kDa in B. vinsonii subsp. vinsonii . This variation correlates with differences in amino acid residue counts: 148 residues in B. henselae, B. quintana, and B. clarridgeiae, 177 in B. elizabethae, 155 in B. vinsonii subsp. berkhoffii, and 234 in B. vinsonii subsp. vinsonii . The significant size difference between the two subspecies of B. vinsonii (17.8 kDa vs. 26.2 kDa) suggests either that these subspecies are more remotely related than previously thought or that genetic exchange involving this gene has accelerated evolutionary divergence . The conservation of size among B. henselae, B. quintana, and B. clarridgeiae despite sequence differences may indicate functional constraints on the protein's structure .

How can researchers use the 17-kDa antigen gene for phylogenetic analysis of Bartonella species?

The 17-kDa antigen gene offers a valuable tool for phylogenetic analysis of Bartonella species, complementing other genetic markers. Researchers should: (1) Amplify and sequence the complete 17-kDa antigen gene from multiple isolates of each Bartonella species using the optimized primer pairs ; (2) Perform multiple sequence alignment of both nucleotide and deduced amino acid sequences to identify conserved and variable regions ; (3) Construct phylogenetic trees using appropriate evolutionary models, comparing the resulting topology with trees based on other genetic markers like 16S rRNA, gltA, or rpoB ; (4) Analyze patterns of positive or purifying selection across different regions of the gene to identify functionally important domains ; (5) Compare sequence divergence percentages between species pairs to establish genetic distance relationships ; (6) Investigate potential horizontal gene transfer events, particularly for species showing unexpected phylogenetic placement based on the 17-kDa antigen gene compared to other markers .

What experimental protocols are recommended for resolving the absence of the 17-kDa antigen gene in B. bacilliformis?

To conclusively determine whether B. bacilliformis truly lacks a homolog of the 17-kDa antigen gene or if technical limitations have prevented its detection, researchers should implement the following experimental protocols: (1) Employ whole genome sequencing of multiple B. bacilliformis strains followed by comprehensive bioinformatic analysis to search for distant homologs ; (2) Design degenerate primers based on the most highly conserved regions from all known 17-kDa antigen gene sequences, accounting for codon usage bias in B. bacilliformis ; (3) Use Southern blot hybridization with probes derived from conserved regions of the gene under low-stringency conditions to detect distantly related sequences ; (4) Perform proteomic analysis of B. bacilliformis through 2D gel electrophoresis and mass spectrometry to identify proteins of similar molecular weight that might represent functional analogs ; (5) Investigate whether B. bacilliformis expresses alternative immunodominant antigens that might serve similar functions to the 17-kDa antigen in other Bartonella species ; (6) Examine the genomic region in B. bacilliformis corresponding to the location of the 17-kDa antigen gene in other Bartonella species to identify potential gene loss events .