Beta-glucosyl-HMC-alpha-glucosyl-transferase Antibody

What are the primary functions of DNA glucosyltransferases in different biological systems?

DNA glucosyltransferases serve distinct biological functions across different organisms. In bacteriophages like T4, beta-glucosyltransferase (β-GT) catalyzes the transfer of glucose from uridine diphosphoglucose (UDP-glucose) to 5-hydroxymethylcytosine (5-hmC) in double-stranded DNA, protecting viral DNA from host restriction endonucleases . This glucosylation occurs immediately after DNA synthesis and forms beta-glycosidic linkages .

In trypanosomatids like Trypanosoma brucei, a different glucosyltransferase called JGT (J-associated glucosyltransferase) transfers glucose to 5-hydroxymethyluracil (hmU) to form base J (β-D-glucopyranosyloxymethyluracil), an important epigenetic mark that regulates gene expression, particularly of variant surface glycoproteins that protect the parasite from immune recognition .

In mammalian systems, glucosylation of 5-hmC can be utilized as a tool to detect and analyze this epigenetic mark, which is generated by TET (Ten-Eleven Translocation) enzymes through oxidation of 5-methylcytosine (5-mC) .

How do DNA beta-glucosyltransferases mechanistically catalyze glycosyl transfer reactions?

The catalytic mechanism of DNA beta-glucosyltransferases involves several key steps and critical residues:

• The enzyme binds two substrates: UDP-glucose and the target DNA containing the modified base (e.g., 5-hmC) .

• Glucose transfer occurs through direct nucleophilic attack by the hydroxyl group of the modified base on the UDP-glucose, forming a beta-glycosidic bond .

• A catalytic base, typically Asp100, abstracts a proton from the hydroxyl group of the modified base, activating it for nucleophilic attack .

• The glucose transfer proceeds via an oxocarbenium ion-character transition state, resulting in inversion of configuration and formation of a beta-glycosidic linkage .

The catalytic domain contains a central six-stranded β-sheet flanked by α helices, consistent with the GT-A group of glycosyltransferases . The following catalytic residues play crucial roles:

Metal ions, particularly Mn²⁺, are essential cofactors that coordinate with the UDP-glucose during the catalytic process .

What is the relationship between 5-hydroxymethylcytosine (5-hmC) and glucosyltransferase activity in epigenetic regulation?

5-hydroxymethylcytosine (5-hmC) serves as a critical intermediate in DNA demethylation pathways and functions as an epigenetic mark distinct from 5-methylcytosine (5-mC). The relationship between 5-hmC and glucosyltransferase activity is multifaceted:

• In mammalian systems, 5-hmC is produced by TET enzymes that oxidize 5-mC, representing a key step in active DNA demethylation .

• While mammals do not naturally glucosylate 5-hmC, the ability of phage-encoded β-GT to specifically recognize and modify 5-hmC has been leveraged as a powerful tool for detecting and quantifying this epigenetic mark .

• Glucosylation of 5-hmC by β-GT creates glucosylated-5-hmC (5-ghmC), which can be further modified for detection purposes in techniques like the Hydroxymethyl Collector™ method .

• Analysis of global 5-hmC content in various genomic DNAs reveals tissue-specific patterns. Brain tissues from mouse, human, and bovine sources contain 0.5-0.9% of total nucleotides as 5-hmC, which is higher than levels found in other tissues .

• Cancer genomes typically show lower percentages of 5-hmC compared to healthy tissues, potentially reflecting the global hypomethylation of 5-mC observed during oncogenesis .

These findings highlight how glucosyltransferase-based detection systems have advanced our understanding of 5-hmC distribution and dynamics in different biological contexts.

How can β-glucosyltransferase be used to quantify global 5-hmC content in genomic DNA?

β-glucosyltransferase offers a robust method for quantifying global 5-hmC content in genomic DNA through the following protocol:

• Enzyme reaction setup: Prepare a reaction containing recombinant β-GT, genomic DNA sample, and radiolabeled UDP-[³H]glucose as the glucose donor .

• Enzymatic glucosylation: Incubate the reaction to allow β-GT to specifically transfer labeled glucose to 5-hmC residues in the genomic DNA .

• Product isolation: Purify the labeled DNA to remove excess UDP-[³H]glucose .

• Quantification: Measure the incorporated radioactivity, which directly correlates with the 5-hmC content (correlation coefficient r = 0.9991) .

This method offers several advantages:

• High sensitivity allowing analysis of small DNA samples

• Compatibility with high-throughput formats

• Ability to detect variations in 5-hmC levels across different tissues and species

Global 5-hmC measurements conducted using this method have revealed tissue-specific patterns. For example, brain tissues from mouse, human, and bovine sources typically contain 0.5-0.9% of total nucleotides as 5-hmC, significantly higher than levels found in other tissues. Moreover, cancer genomes show consistently lower 5-hmC percentages compared to healthy tissues, potentially reflecting the global hypomethylation observed during oncogenesis .

What are the optimal conditions for expressing and purifying recombinant β-glucosyltransferase for research applications?

For optimal expression and purification of recombinant β-glucosyltransferase, researchers should consider the following conditions:

• Expression System: Recombinant β-GT is typically expressed in Escherichia coli expression systems. Commercial preparations like ab198660 use this system to express the full-length protein (amino acids 1-351) of Enterobacteria phage T4 origin .

• Expression Construct: For structural studies, the amino-terminal domain (residues 1-211) containing the glycosyltransferase activity can be expressed separately, as demonstrated in crystallization studies yielding 1.6 Å resolution structures .

• Affinity Tags: Adding an HA-tag at the N-terminus facilitates purification and detection. For example, in T. brucei studies, researchers successfully used the sequence ATGGCTTACCCATATGATGTTCCAGATTACGCT coding for the HA tag (in bold in the original study) fused to the JGT sequence .

• Protein Purity: For research applications, a purity of ≥83% is typically suitable for SDS-PAGE and functional assays .

• Functional Testing: Activity can be verified through in vitro assays using UDP-glucose as the donor and DNA containing 5-hmC as the acceptor substrate. The ability to transfer glucose from UDP-glucose to 5-hmC in double-stranded DNA is the key functional characteristic .

• Storage Conditions: Proper storage in buffer containing glycerol at -20°C or -80°C helps maintain enzymatic activity.

Successful purification yields a catalytically active enzyme that follows a random sequential reaction mechanism, binding either UDP-glucose or 5-hmC DNA in random order, with both binary complexes being catalytically competent .

How can glucosyltransferase-based methods be integrated with other techniques for comprehensive epigenetic profiling?

Glucosyltransferase-based methods can be effectively integrated with multiple techniques to create comprehensive epigenetic profiling workflows:

• GLIB (Glucosylation, Periodate oxidation, Biotinylation) Method:

  • Utilize β-GT to glucosylate 5-hmC in genomic DNA

  • Oxidize the glucosyl groups with periodate

  • Label the resulting aldehyde groups with biotin

  • Enrich biotinylated DNA fragments for sequencing or array analysis

• Combined Antibody Approaches:

  • Use β-GT-based detection of 5-hmC alongside antibody-based detection of other epigenetic marks such as 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC)

  • This allows simultaneous profiling of multiple cytosine modifications in developmental studies, as demonstrated in embryonic studies where 5-fC and 5-caC show asymmetric distribution in sister chromatids at the two-cell stage

• Integration with Bisulfite Sequencing:

  • Glucosylation of 5-hmC protects it from bisulfite conversion

  • This protection enables differential analysis to distinguish between 5-mC and 5-hmC

  • When combined with standard bisulfite sequencing, this approach provides base-resolution maps of both 5-mC and 5-hmC

• Hydroxymethyl Collector™ Method:

  • Utilizes β-glucosyltransferase to modify 5-hmC residues with glucose

  • The modified base can then be specifically isolated and analyzed

  • This approach allows for enrichment of 5-hmC-containing DNA fragments for downstream analysis

• Mass Spectrometry Integration:

  • Glucosylated DNA can be digested to nucleosides

  • LC-MS/MS analysis can provide quantitative information on modified bases

  • This combination offers absolute quantification of multiple modified bases simultaneously

These integrated approaches provide more comprehensive insights into the epigenetic landscape than any single method alone.

How do mutations in specific catalytic domains of β-glucosyltransferase affect enzyme kinetics and substrate specificity?

Mutations in the catalytic domains of β-glucosyltransferase have significant and specific effects on enzyme kinetics and substrate specificity, providing important insights into structure-function relationships:

• DXD Motif Mutations: Mutations in this highly conserved motif (domain 3) directly impact catalytic activity. In studies of the A64R glucosyltransferase from Chlorella virus, single nucleotide substitutions in this motif altered glycosylation patterns of the major capsid protein. Specifically, these mutations changed the ratio of sugars (glucose, fucose, galactose, mannose, xylose, rhamnose, and arabinose) attached to the viral capsid protein, correlating with altered migration patterns on SDS-PAGE .

• Domain 4 Mutations: Single amino acid substitutions in domain 4 also affect glycosylation activity, as demonstrated in antigenic variants with altered glycan compositions .

• Binding Site Alterations: Crystal structures of the T4 β-GT complexed with UDP, CMP, or GDP revealed that only UDP bound to β-GT in the presence of Mn²⁺, consistent with its structural similarity to glycosyltransferases that use UDP as the sugar carrier. Mutations affecting this binding specificity alter substrate selection .

• Sugar Selectivity: The wild-type β-GT preferentially binds UDP-glucose, with much lower affinity for UDP-galactose and UDP-GlcNAc. Mutations near the sugar-binding pocket can modify this selectivity .

• Catalytic Residue Mutations: Alterations to key catalytic residues like Asp100 (proton acceptor) significantly impair catalytic activity. A systematic analysis of mutations to catalytic residues showed that conserved catalytic residues (Asp100, Arg191, Phe72, and Glu22) are essential for efficient catalysis .

Kinetic analyses of wild-type and mutant enzymes reveal that β-GT operates through a nonprocessive mechanism, with the enzyme releasing from the DNA substrate after each catalytic cycle. Both binary enzyme-substrate complexes (enzyme-UDP-glucose and enzyme-DNA) are catalytically competent, indicating a random sequential reaction mechanism .

What are the structural determinants of substrate recognition by DNA glucosyltransferases across different biological systems?

DNA glucosyltransferases from different biological systems exhibit distinct structural features that govern their substrate recognition while maintaining a conserved catalytic core:

• Core Structural Features:

  • Most DNA glucosyltransferases share a GT-A fold with a central six-stranded β-sheet flanked by α-helices

  • The nucleotide-binding domain contains a characteristic Rossmann-like fold for binding the UDP-glucose donor

  • The catalytic domain features conserved DXD motifs that coordinate metal ions (typically Mn²⁺) essential for catalysis

• Target Base Recognition:

  • T4 phage β-GT specifically recognizes 5-hmC in DNA with high selectivity

  • JGT from trypanosomatids targets 5-hydroxymethyluracil (hmU) instead

  • These differences arise from specific amino acid configurations in the DNA-binding pocket that distinguish between the pyrimidine bases

• Structural Studies:

  • Crystal structures of the A64R glycosyltransferase domain (residues 1-211) from Chlorella virus at 1.6 Å resolution reveal the structural basis for nucleotide recognition

  • Complexes with UDP, CMP, or GDP demonstrated that only UDP bound to the enzyme in the presence of Mn²⁺, explaining the specificity for UDP-glucose as the donor substrate

• Context-Dependent Recognition:

  • The number of target modifications (e.g., 5-hmC) in a DNA sequence influences turnover rates, suggesting cooperative interactions with the substrate

  • β-GT binds approximately 10-fold stronger to unmodified 5-hmC DNA compared to its glucosylated product (5-ghmC DNA), highlighting the role of product release in enzymatic turnover

• Species-Specific Differences:

  • Bacteriophage T4 β-GT forms beta-glycosidic linkages to 5-hmC

  • In contrast, some related enzymes form alpha-glycosidic linkages to the same base

  • These differences result from distinct structural configurations of the active site that control the stereochemistry of the reaction

The structural differences in substrate recognition have been leveraged for biotechnological applications, particularly in the selective detection and quantification of modified bases in epigenetic studies .

How do epigenetic modifications like 5-hmC vary across different tissues and disease states, and what methods best capture these differences?

Epigenetic modifications, particularly 5-hydroxymethylcytosine (5-hmC), show significant variation across tissues and disease states, with specialized methods required to accurately capture these differences:

• Tissue-Specific Variation:

  • Brain tissues from mouse, human, and bovine sources contain significantly higher levels of 5-hmC (0.5-0.9% of total nucleotides) compared to other tissues

  • This tissue-specific enrichment suggests 5-hmC plays particularly important roles in neuronal function and brain development

  • A study measuring [³H]glucose incorporation revealed strong correlation (r = 0.9991) between the radioactive signal and total 5-hmC content across different mouse tissues at various developmental stages

• Disease-Associated Changes:

  • Cancer genomes consistently show lower percentages of 5-hmC compared to healthy tissues from the same origin

  • This reduction may reflect the global hypomethylation of 5-mC often observed during oncogenesis

  • Specific alterations in 5-hmC patterns have been linked to various neurological disorders and inflammatory conditions

• Developmental Dynamics:

  • 5-hmC levels are diminished by half in blastomeres with each round of DNA replication during early development

  • Antibody-based detection has revealed that at the two-cell stage, only one of two sister chromatids is enriched for 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC), downstream oxidation products of 5-hmC

• Optimal Detection Methods:

  • Global Quantification: β-GT-mediated incorporation of radiolabeled glucose provides sensitive measurement of total 5-hmC content, requiring minimal DNA input (suitable for precious samples)

  • Genome-wide Mapping: Techniques combining β-GT treatment with next-generation sequencing provide comprehensive distribution maps

  • Single-Base Resolution: Oxidative bisulfite sequencing methods differentiate 5-hmC from 5-mC at base resolution

  • Antibody-Based Detection: Immunofluorescence using specific antibodies against 5-hmC, 5-fC, and 5-caC enables visualization of these marks in fixed cells and tissues

• Comparative Method Performance:

  • β-GT-mediated determination of global 5-hmC levels shows high consistency with other analytical methods while offering advantages in simplicity and throughput

  • The method has been successfully applied to over 40 different genomic DNA samples spanning 13 different prokaryotic and eukaryotic species

These findings highlight the importance of selecting appropriate detection methods based on research questions and sample characteristics when studying the dynamic nature of 5-hmC in different biological contexts.

What are the common challenges in β-glucosyltransferase assays and how can they be addressed?

Researchers working with β-glucosyltransferase assays frequently encounter several technical challenges that can impact experimental results. Here are the most common issues and their solutions:

• Substrate Quality and Purity:

  • Challenge: Contaminated or degraded UDP-glucose can significantly reduce enzymatic activity.

  • Solution: Use freshly prepared UDP-glucose solutions and store aliquots at -80°C to maintain integrity. Verify purity by HPLC if inconsistent results are observed .

• Enzyme Stability:

  • Challenge: β-GT activity may decrease during storage or experimental manipulation.

  • Solution: Add stabilizing agents such as glycerol (10-20%) and DTT (1-5 mM) to storage buffers. Avoid repeated freeze-thaw cycles by preparing single-use aliquots .

• Metal Ion Dependency:

  • Challenge: Insufficient or incorrect metal cofactors lead to reduced activity.

  • Solution: Ensure adequate Mn²⁺ concentration (typically 5-10 mM) in reaction buffers, as crystal structure studies confirm this is the preferred metal ion for β-GT activity .

• DNA Substrate Accessibility:

  • Challenge: Highly structured DNA may limit access to 5-hmC sites.

  • Solution: For difficult templates, include brief heat denaturation followed by slow cooling prior to enzyme addition. Alternatively, increase reaction time or enzyme concentration for complex DNA substrates .

• Product Inhibition:

  • Challenge: UDP and glucosylated DNA products can inhibit the reaction.

  • Solution: Product inhibition studies show UDP is a competitive inhibitor with respect to UDP-glucose and a mixed inhibitor with respect to 5-hmC DNA. Similarly, glucosylated-5-hmC (5-ghmC) DNA is a competitive inhibitor with respect to 5-hmC DNA. Considering these kinetic properties, using excess UDP-glucose can help overcome UDP inhibition .

• Non-specific Binding:

  • Challenge: Non-specific binding to reaction vessels can reduce enzyme availability.

  • Solution: Include BSA (0.1-0.5 mg/ml) in reaction buffers to block non-specific binding sites.

• Quantification Accuracy:

  • Challenge: Background signal in radioactive assays can confound measurements.

  • Solution: Include appropriate negative controls (DNA lacking 5-hmC) to establish background levels for subtraction from experimental samples .

Following these troubleshooting strategies can significantly improve the reliability and reproducibility of β-glucosyltransferase assays in epigenetic research.

How should researchers analyze and interpret data from glucosyltransferase-based 5-hmC detection experiments?

Proper analysis and interpretation of data from glucosyltransferase-based 5-hmC detection experiments require careful consideration of multiple factors:

• Establishing Appropriate Controls:

  • Include both positive controls (DNA with known 5-hmC content) and negative controls (DNA lacking 5-hmC) in each experimental batch

  • Use serial dilutions of standards to generate calibration curves for quantitative analysis

  • When comparing different tissues or conditions, include reference samples with established 5-hmC levels

• Normalization Strategies:

  • For radioactive assays, normalize incorporation data to DNA input amount

  • When comparing across different DNA samples, consider normalizing to global cytosine content

  • For time-course experiments, analyze relative changes rather than absolute values to minimize batch effects

• Statistical Analysis:

  • Apply appropriate statistical tests based on experimental design (t-tests for simple comparisons, ANOVA for multiple comparisons)

  • Report both statistical significance and effect sizes

  • Consider biological relevance alongside statistical significance when interpreting differences in 5-hmC levels

• Data Visualization:

  • Present data in formats that highlight tissue-specific or condition-specific patterns

  • When comparing multiple samples, consider heatmaps or clustered bar graphs to illustrate relationships

  • Include error bars representing biological and technical variation

• Interpretation Guidelines:

  • Interpret 5-hmC levels in relation to known tissue patterns (e.g., expect higher levels in brain tissue)

  • Consider developmental stage when analyzing embryonic or developmental samples

  • For disease studies, compare matched tissue types (cancer vs. adjacent normal tissue)

  • Note that cancer genomes typically show lower percentages of 5-hmC compared to healthy tissues, potentially reflecting global hypomethylation during oncogenesis

• Integration with Other Data Types:

  • Correlate 5-hmC levels with gene expression data when available

  • Compare patterns with other epigenetic marks (5-mC, histone modifications)

  • Consider genomic context (promoters, gene bodies, enhancers) when interpreting localized 5-hmC changes

• Technical Considerations:

  • Be aware that 5-hmC binds approximately 10-fold stronger to β-GT compared to its glucosylated product, which may impact kinetics in samples with varying 5-hmC density

  • The number of 5-hmC sites on target sequences influences turnover numbers for the enzyme, which should be considered when comparing densely vs. sparsely modified regions

These analytical approaches ensure robust and biologically meaningful interpretation of glucosyltransferase-based 5-hmC detection data.

What factors affect the specificity and sensitivity of glucosyltransferase-mediated detection of modified bases?

Multiple factors influence the specificity and sensitivity of glucosyltransferase-mediated detection of modified bases, with implications for experimental design and data interpretation:

Understanding these factors allows researchers to optimize experimental conditions for maximal specificity and sensitivity when using glucosyltransferase-mediated detection of modified bases.

How might glucosyltransferase engineering advance epigenetic research and biotechnology applications?

Glucosyltransferase engineering presents numerous opportunities to advance both fundamental epigenetic research and biotechnology applications:

• Enhanced Specificity and Activity:

  • Rational design based on crystal structures can yield β-GT variants with increased catalytic efficiency

  • Engineering enzymes with altered base specificity could enable detection of other rare DNA modifications beyond 5-hmC

  • Directed evolution approaches might generate β-GT variants that function under broader reaction conditions or with novel substrates

• Expanded Sugar Donor Compatibility:

  • Engineering β-GT to accept modified UDP-glucose donors could enable direct attachment of functional groups (biotin, fluorophores, click chemistry handles)

  • Current methods show β-GT selectively binds UDP-glucose over UDP-galactose or UDP-GlcNAc; altering this specificity could enable new types of DNA labeling

• Novel Detection Technologies:

  • Creating β-GT fusion proteins with fluorescent reporters could enable real-time monitoring of enzyme activity

  • Split-enzyme complementation systems based on β-GT fragments could be developed for proximity-based detection of protein-DNA interactions

  • Engineered allosteric control of β-GT activity might enable precise temporal control of labeling reactions

• Therapeutic Applications:

  • Just as pathogens use glycosyltransferases to modify host targets (e.g., IgG glycosylation by pathogens to circumvent immune recognition), engineered β-GT variants could potentially modify specific genomic loci to alter gene expression

  • Targeted glucosylation of specific genomic regions might be achieved by fusing β-GT to programmable DNA-binding domains like CRISPR-Cas systems

• Single-Molecule Applications:

  • Engineering β-GT for compatibility with single-molecule detection systems could enable visualization of epigenetic marks at unprecedented resolution

  • Integration with nanopore sequencing technologies might allow direct reading of glucosylated bases during DNA sequencing

• Multi-Functional Enzyme Development:

  • Creating chimeric enzymes that combine β-GT activity with other DNA-modifying functions could streamline complex epigenetic analysis workflows

  • Engineering glucosyltransferases that simultaneously recognize multiple modified bases would enable more comprehensive epigenetic profiling

These engineering approaches build upon our detailed understanding of β-GT structure and mechanism, particularly the crystal structures that reveal the enzyme's mixed α/β fold containing a central six-stranded β sheet flanked by α helices, and the key catalytic residues like Asp100, Arg191, Phe72, and Glu22 .

What emerging technologies might leverage glucosyltransferase activity for novel epigenetic analysis approaches?

Several emerging technologies are poised to leverage glucosyltransferase activity for innovative epigenetic analysis approaches:

• Single-Cell Epigenomics:

  • Microfluidic systems could integrate β-GT reactions with single-cell isolation to analyze 5-hmC patterns at single-cell resolution

  • This would reveal cell-to-cell epigenetic heterogeneity in complex tissues like brain, where 5-hmC levels are particularly high (0.5-0.9% of total nucleotides)

  • Combining with single-cell RNA-seq would enable direct correlation between 5-hmC patterns and gene expression in the same cell

• Spatial Epigenomics:

  • In situ glucosylation of 5-hmC followed by proximity ligation could enable spatial mapping of 5-hmC in tissue sections

  • This approach would preserve the tissue architecture while revealing the distribution of epigenetic marks in relation to cellular organization

  • Particularly valuable for heterogeneous tissues where cell type-specific epigenetic patterns are important

• Nanopore-Based Detection:

  • Glucosylated 5-hmC creates a larger structure that could produce distinctive current blockade signatures in nanopore sequencing

  • This could enable direct reading of epigenetic modifications during DNA sequencing without prior conversion or amplification

  • Would overcome limitations of bisulfite-based methods that cannot distinguish 5-mC from 5-hmC

• CRISPR-Based Targeting:

  • Fusing catalytically inactive Cas9 (dCas9) with β-GT could enable targeted glucosylation of specific genomic regions

  • This approach would allow locus-specific analysis of 5-hmC distribution

  • Could be combined with next-generation sequencing for high-resolution mapping

• Integrated Epigenetic Profiling Platforms:

  • Automated systems combining β-GT treatment with downstream analysis (sequencing, array detection) would streamline workflow

  • High-throughput platforms could process large sample collections for population-level epigenetic studies

  • Would build upon current methods that have been validated across multiple species and tissue types

• Real-Time Monitoring Systems:

  • Coupling β-GT activity with real-time detection systems (fluorescence, electrochemical) could enable dynamic monitoring of 5-hmC levels

  • Would allow temporal studies of epigenetic changes during development or disease progression

  • Particularly relevant for studying epigenetic dynamics in embryonic development, where 5-hmC patterns change rapidly

• Multi-Modal Epigenetic Analysis:

  • Systems integrating β-GT-based 5-hmC detection with analysis of other epigenetic marks (histone modifications, chromatin accessibility)

  • Would provide comprehensive view of the epigenetic landscape

  • Could leverage findings that 5-hmC levels in cancer genomes are lower than in healthy tissues, potentially reflecting global hypomethylation during oncogenesis

These technologies build upon the established biochemical properties of β-GT, including its high specificity for 5-hmC in double-stranded DNA and its well-characterized reaction mechanism .