BHMT Antibody

What is BHMT and what is its biological significance?

BHMT (betaine-homocysteine methyltransferase) is a zinc metalloenzyme belonging to the methyltransferase family that catalyzes the conversion of homocysteine to methionine using betaine as a methyl donor. The human canonical protein has 406 amino acid residues with a molecular mass of approximately 45 kDa. It plays a critical role in homocysteine metabolism and is involved in the regulation of one-carbon metabolism pathways . BHMT is predominantly expressed in the kidney and liver tissues, where it contributes to maintaining methionine levels and regulating homocysteine concentrations. The enzyme's function is particularly important because elevated homocysteine levels have been associated with various pathological conditions including cardiovascular disease and neurological disorders. BHMT should not be confused with BHMT2, which is a related but distinct enzyme with different expression patterns and characteristics .

What are the recommended applications for BHMT antibodies in research?

BHMT antibodies are versatile research tools with multiple validated applications across different experimental platforms. Based on extensive testing, the primary applications include:

For optimal results, it is strongly recommended to titrate the antibody concentration for each specific experimental setup and sample type. The antibody performance may vary depending on tissue fixation methods, protein extraction protocols, and detection systems employed . When performing IHC, antigen retrieval with TE buffer (pH 9.0) is suggested, though citrate buffer (pH 6.0) may serve as an alternative . For Western blot applications, the expected molecular weight range is 45-50 kDa, which aligns with the calculated molecular weight of 45 kDa for the 406 amino acid protein .

How should BHMT antibody samples be handled and stored for optimal performance?

Proper handling and storage of BHMT antibodies are critical for maintaining their specificity and sensitivity over time. Most commercial BHMT antibodies are supplied as liquid formulations in storage buffers containing preservatives. For the polyclonal antibody referenced in the search results:

When working with the antibody, always avoid repeated freeze-thaw cycles as they can lead to protein denaturation and loss of binding activity. Always centrifuge the antibody vial briefly before opening to collect all the liquid at the bottom of the tube. For daily use, the antibody can be kept at 4°C for up to one week, but should be returned to -20°C for long-term storage . When using the antibody in various applications, equilibrate all reagents to room temperature prior to use for optimal binding characteristics and reproducible results .

What controls should be included when using BHMT antibodies in experimental procedures?

Rigorous experimental design requires appropriate controls to validate results and ensure specificity when using BHMT antibodies. Based on research practices:

For BHMT siRNA controls, researchers have successfully used sequences targeting specific regions of BHMT. For example, a forward siRNA sequence of 5′-GUGAAGACAAGCUGGAAAAd(TT)-3′ and reverse RNA sequence of 3′-d(TT)CACUUCUGUUCGACCUUUU-5′, which targets the BHMT sequence of AAGTGAAGACAAGCTGGAAAA, has been validated for BHMT knockdown experiments . When performing immunohistochemistry, always include appropriate blocking steps and validate staining patterns by comparing with reported tissue expression profiles of BHMT .

How can researchers investigate the interaction between BHMT and BHMT2?

To study this interaction:

• Co-transfection approach: Transfect cells with constructs for both BHMT and HA-tagged BHMT2. This tagging strategy facilitates detection of the otherwise unstable BHMT2 protein.

• Co-immunoprecipitation protocol:

  • Lyse cells transfected with BHMT, HA-tagged BHMT2, or both

  • Incubate cell lysates with anti-HA-agarose for 1 hour

  • Wash the beads thoroughly to remove unbound proteins

  • Elute bound proteins with SDS sample buffer

  • Analyze by Western blot to detect the presence of both proteins

• Stabilization strategy: Include homocysteine in experimental buffers, as evidence suggests it can "stabilize" BHMT2 and potentially enhance the detection of BHMT-BHMT2 interactions .

• Controls: Include single-transfection controls to distinguish between specific interactions and non-specific binding. Also consider crosslinking approaches to capture transient interactions that might be disrupted during standard immunoprecipitation procedures.

This experimental approach can help elucidate the functional significance of BHMT-BHMT2 interactions in homocysteine metabolism and potentially explain why BHMT2 function remains poorly characterized despite its sequence similarity to BHMT .

What methodologies are effective for studying BHMT variant allozymes and polymorphisms?

Investigating BHMT genetic variations and their functional consequences requires a multifaceted approach:

• Identification of genetic variants:

  • PCR amplification and direct sequencing of BHMT coding regions

  • Analysis of 5′-flanking regions to identify potential regulatory polymorphisms

  • Genotyping of identified single nucleotide polymorphisms (SNPs) in population samples

• Functional genomic studies:

  • Construction of expression vectors containing variant BHMT sequences

  • Transfection of these constructs into appropriate cell lines (HepG2 cells have been successfully used)

  • Measurement of enzyme activity using appropriate substrates

  • Assessment of protein stability and expression levels

• Analysis of 5′-flanking region (5′-FR) haplotypes:

  • Construct reporter gene assays to evaluate the impact of promoter variants on gene expression

  • Compare activity of different haplotypes to identify regulatory effects

  • Assess haplotype frequencies in different populations or disease states

• Protein interaction studies:

  • Evaluate whether specific variants affect interactions with BHMT2 or other proteins

  • Use co-immunoprecipitation to assess protein-protein interactions

  • Consider the impact of homocysteine on protein stability and interactions

These methodologies have successfully identified functional implications of BHMT polymorphisms, providing insights into how genetic variation affects enzyme function and potentially contributes to disease susceptibility. Unlike BHMT, attempts to conduct similar studies with BHMT2 have been complicated by difficulties in expressing BHMT2 in mammalian cells, highlighting the technical challenges in studying this related enzyme .

How can BHMT antibodies be utilized to investigate homocysteine-induced cellular injury?

BHMT antibodies serve as valuable tools for investigating the protective role of BHMT against homocysteine-induced cellular injury, particularly in hepatocytes. A methodological approach includes:

• Establishing cellular models:

  • Create stable BHMT-expressing cell lines (e.g., BHMT transfectants of HepG2 cells)

  • Isolate primary hepatocytes from appropriate animal models

  • Design BHMT knockdown models using validated siRNA constructs

• Experimental protocol for lipid accumulation studies:

  • Treat cells with homocysteine at varying concentrations and time points

  • Extract cellular lipids using chloroform-methanol (2:1) extraction

  • Centrifuge the extraction mixture and collect the organic phase

  • Vacuum-dry and resuspend in 2-propanol containing 10% Triton X-100

  • Quantify triglycerides using appropriate reagents (e.g., Sigma Diagnostics triglyceride reagent)

  • Measure cholesterol using quantitation kits (e.g., BioVision cholesterol quantitation kit)

• BHMT protein detection:

  • Generate or obtain specific anti-BHMT antibodies (polyclonal antibodies have been generated with an antigenic peptide sequence of SEDKLENRGNYVLEKI)

  • Use these antibodies for Western blot analysis to confirm BHMT expression levels

  • Perform immunofluorescence to visualize BHMT localization within cells

• Knockdown experiments:

  • Transfect cells with BHMT siRNA using appropriate transfection reagents

  • Incubate cells for 24-48 hours post-transfection

  • Confirm knockdown efficiency by Western blot using BHMT antibodies

  • Compare lipid accumulation and cell injury markers between knockdown and control cells

This experimental approach has revealed that BHMT protects hepatocytes from homocysteine-induced injury and lipid accumulation, providing mechanistic insights into the role of BHMT in liver pathophysiology and potential therapeutic targets for conditions characterized by hyperhomocysteinemia .

What are the optimal protocols for quantitative measurement of BHMT using ELISA?

The SimpleStep ELISA technique offers a sensitive method for quantitative measurement of BHMT protein in tissue extracts. The protocol involves:

• Sample preparation:

  • Prepare tissue extracts from human, mouse, or rat samples

  • Ensure proper homogenization and protein extraction

  • Determine protein concentration using standard methods (BCA or Bradford assay)

  • Dilute samples appropriately within the assay's linear range

• Assay procedure:

  • Equilibrate all reagents and prepared samples to room temperature

  • Add 50 μL of standard or sample to appropriate wells

  • Add 50 μL of Antibody Cocktail (containing both capture and detector antibodies) to all wells

  • Seal the plate and incubate for 1 hour at room temperature on a plate shaker (400 rpm)

  • Wash each well with 3 × 350 μL 1X Wash Buffer PT, ensuring complete removal of liquid

  • Add 100 μL of TMB Development Solution to each well and incubate for 10 minutes in the dark

  • Add 100 μL of Stop Solution to each well and mix by shaking

  • Record the optical density at 450 nm

• Alternative kinetic measurement:

  • Instead of endpoint reading, record the development of TMB Substrate kinetically

  • Begin recording blue color development immediately after adding TMB Development Solution

  • Measure absorbance at 600 nm at regular intervals

• Data analysis:

  • Generate a standard curve using the provided standards

  • Ensure the curve encompasses the range of expected sample concentrations

  • Calculate BHMT concentrations in unknown samples by interpolating from the standard curve

  • Account for any dilution factors applied to the original samples

The SimpleStep ELISA method employs an affinity tag labeled capture antibody and a reporter conjugated detector antibody that immunocapture the BHMT analyte in solution. This entire complex is immobilized via immunoaffinity of an anti-tag antibody coating the well, allowing for specific and sensitive detection of BHMT protein .

What considerations are important when using BHMT antibodies for cross-species applications?

When utilizing BHMT antibodies across different species, researchers must consider several factors to ensure validity and reproducibility:

Cross-reactivity considerations:

• Sequence homology assessment:

  • BHMT is highly conserved across mammals, with significant homology in functional domains

  • Human BHMT shares substantial sequence identity with mouse and rat orthologs

  • Antibodies raised against conserved epitopes are more likely to cross-react

• Validation approaches:

  • Always perform preliminary experiments to verify specificity in each species

  • Include positive controls from species with confirmed reactivity

  • Use tissues known to express BHMT (primarily kidney and liver)

  • Consider antibody dilution optimization for each species

• Application-specific considerations:

  • For Western blot: Verify that the observed molecular weight matches the predicted size for that species

  • For IHC: Optimize antigen retrieval conditions, as they may differ between species

  • For IP: Adjust antibody amounts based on expression levels in different species

• Expression pattern verification:

  • Confirm that the observed tissue distribution aligns with reported expression patterns

  • Note that while BHMT is primarily expressed in kidney and liver across species, there may be species-specific expression in other tissues

When working with species beyond those explicitly validated, researchers should conduct thorough validation studies before proceeding with full-scale experiments to ensure antibody specificity and appropriate experimental conditions .

What are the common challenges in BHMT antibody-based experiments and how can they be overcome?

Researchers working with BHMT antibodies may encounter several technical challenges that can be addressed through methodological adjustments:

• Cross-reactivity with BHMT2:

  • Challenge: BHMT and BHMT2 share sequence similarity, potentially leading to cross-reactivity.

  • Solution: Verify antibody specificity by using lysates from cells expressing only BHMT or BHMT2. Consider using epitope-specific antibodies that target unique regions of each protein. For critical experiments, validate findings using multiple antibodies targeting different epitopes .

• Variable BHMT expression levels:

  • Challenge: BHMT expression varies significantly between tissues and experimental conditions.

  • Solution: Optimize protein loading for each tissue type. For Western blot, consider using graduated loading amounts to establish a linear detection range. For IHC, adjust antibody dilutions based on the expected expression level in the target tissue .

• Protein stability issues:

  • Challenge: BHMT2 particularly shows stability problems during expression and extraction.

  • Solution: Consider adding homocysteine to stabilize the protein during extraction. Use freshly prepared lysates whenever possible, and avoid prolonged storage of samples intended for BHMT analysis. For co-immunoprecipitation studies involving BHMT2, co-expression with BHMT may improve stability .

• Background in immunohistochemistry:

  • Challenge: Non-specific binding in tissue sections, particularly in highly vascular tissues.

  • Solution: Optimize blocking conditions using both serum and protein blockers. Consider antigen retrieval optimization using either TE buffer (pH 9.0) or citrate buffer (pH 6.0) depending on the tissue type. Increase washing steps and duration to reduce background staining .

• Antibody performance in ELISA applications:

  • Challenge: Matrix effects from tissue extracts affecting antibody binding.

  • Solution: Prepare careful dilution series of samples to ensure measurements fall within the linear range of the assay. Consider adding carrier proteins to standards to match sample conditions. Validate results using spike-recovery tests with known amounts of recombinant BHMT protein .

Implementing these methodological refinements can significantly improve the reliability and reproducibility of BHMT antibody-based experiments, allowing for more accurate assessment of BHMT expression and function in various biological contexts.

How can researchers validate BHMT antibody specificity for their particular experimental system?

Establishing antibody specificity is crucial for generating reliable data in BHMT research. A comprehensive validation strategy includes:

• Multiple detection methods comparison:

  • Use at least two independent methods to detect BHMT (e.g., Western blot and IHC)

  • Compare the results for consistency in expression patterns and localization

  • Verify that the molecular weight observed in Western blot matches the expected size (45-50 kDa)

• Gene modulation approaches:

  • Perform BHMT knockdown using validated siRNA sequences

  • The sequence 5′-GUGAAGACAAGCUGGAAAAd(TT)-3′ (forward) and 3′-d(TT)CACUUCUGUUCGACCUUUU-5′ (reverse) has been successfully used to target BHMT

  • Confirm reduction in both BHMT mRNA (by qPCR) and protein levels (by Western blot)

  • If available, use BHMT knockout tissues or cells as definitive negative controls

• Peptide competition assay:

  • Pre-incubate the BHMT antibody with excess immunizing peptide (if known)

  • If the antibody is specific, the peptide should block binding to BHMT in subsequent applications

  • For polyclonal antibodies raised against the peptide sequence SEDKLENRGNYVLEKI, this sequence can be used for competition assays

• Recombinant protein controls:

  • Express recombinant BHMT in a system that normally lacks BHMT expression

  • Verify detection of the recombinant protein using the antibody

  • Include graduated amounts of recombinant protein to establish detection limits

• Tissue panel validation:

  • Test antibody performance across a panel of tissues with known BHMT expression patterns

  • Kidney and liver should show high expression levels

  • Compare findings with published expression data for consistency

• Cross-reactivity assessment:

  • Test for potential cross-reactivity with BHMT2 and other methyltransferase family members

  • Consider using purified proteins or overexpression systems to evaluate specificity

  • Particularly important when studying tissues that express both BHMT and BHMT2

A systematic implementation of these validation steps ensures that experimental findings accurately reflect BHMT biology rather than artifacts of non-specific antibody binding or detection issues.

What are the recommended procedures for optimizing BHMT antibody dilutions across different applications?

Determining optimal antibody dilutions is essential for balancing specific signal detection with background minimization. Application-specific optimization strategies include:

• Western blot titration protocol:

  • Begin with a broad dilution range (e.g., 1:500, 1:1000, 1:2000, 1:4000, 1:6000)

  • Use consistent protein amounts loaded across all lanes (20-50 μg total protein)

  • Include positive control tissues (kidney or liver) and negative control tissues

  • Evaluate signal-to-noise ratio at each dilution

  • Select the highest dilution that maintains strong specific signal while minimizing background

  • For BHMT antibody 15965-1-AP, the recommended working range is 1:1000-1:6000

• Immunohistochemistry optimization:

  • Start with a moderate dilution (e.g., 1:50) and test serial dilutions (1:20, 1:50, 1:100, 1:200)

  • Process all sections identically regarding antigen retrieval and detection systems

  • Compare staining intensity, specificity, and background across dilutions

  • Evaluate both positive control tissues (kidney, liver) and negative control tissues

  • Test both TE buffer (pH 9.0) and citrate buffer (pH 6.0) for antigen retrieval to determine optimal conditions

  • For BHMT antibody 15965-1-AP, the recommended IHC dilution range is 1:20-1:200

• Immunoprecipitation dilution determination:

  • Test a range of antibody amounts (0.5, 1.0, 2.0, 4.0 μg) per mg of total protein lysate

  • Evaluate the efficiency of target protein pull-down and the level of non-specific binding

  • Compare to a non-specific IgG control to assess background

  • For BHMT antibody 15965-1-AP, 0.5-4.0 μg antibody per 1.0-3.0 mg of total protein lysate is recommended

• ELISA concentration optimization:

  • Follow kit manufacturer's instructions for initial dilution recommendations

  • If developing a custom ELISA, perform checkerboard titrations of capture and detection antibodies

  • Generate standard curves with recombinant BHMT protein to determine the linear detection range

  • Optimize sample dilutions to ensure measurements fall within the standard curve range

  • Validate dilution factors by testing serial dilutions of positive control samples for linearity

These methodical approaches to antibody dilution optimization ensure consistent, reproducible results while minimizing reagent waste and experimental artifacts across different BHMT research applications.

What emerging applications of BHMT antibodies show promise for advancing our understanding of one-carbon metabolism?

BHMT antibodies are increasingly being utilized in novel research contexts that expand our understanding of one-carbon metabolism and related pathways:

• Multi-omics integration approaches:

  • Combining BHMT immunoprecipitation with mass spectrometry (IP-MS) to identify novel interaction partners

  • Correlating BHMT protein levels (detected by antibodies) with metabolomic profiles of methionine cycle intermediates

  • Integrating immunohistochemical BHMT expression data with transcriptomic analyses to identify co-regulated pathways

• Tissue-specific metabolism investigations:

  • Using BHMT antibodies to map expression patterns across diverse tissue types beyond the well-established liver and kidney localizations

  • Investigating cell-type specific expression within heterogeneous tissues using immunofluorescence co-localization with cell-type markers

  • Examining BHMT expression changes during development and aging using antibody-based approaches

• Subcellular localization studies:

  • Exploring the reported nuclear and cytoplasmic localization of BHMT through high-resolution confocal microscopy

  • Investigating potential translocation of BHMT between cellular compartments under various metabolic conditions

  • Developing proximity ligation assays using BHMT antibodies to detect protein-protein interactions in situ

• Pathological mechanisms exploration:

  • Using BHMT antibodies to investigate enzyme expression in various disease models, particularly those related to homocysteine metabolism disorders

  • Developing tissue microarray approaches with BHMT immunostaining to correlate expression levels with clinical outcomes

  • Investigating post-translational modifications of BHMT using modification-specific antibodies in conjunction with pan-BHMT antibodies

• Therapeutic development applications:

  • Utilizing BHMT antibodies in high-throughput screening assays to identify compounds that modulate BHMT stability or activity

  • Developing immunoassays to monitor BHMT levels as potential biomarkers for metabolic disorders

  • Creating antibody-based approaches to manipulate BHMT function in cellular models

These emerging applications leverage the specificity of BHMT antibodies to advance our understanding beyond basic enzyme characterization, potentially opening new avenues for diagnostic and therapeutic interventions in conditions associated with dysregulated one-carbon metabolism .

How might advances in antibody technology improve future studies of BHMT and BHMT2 interactions?

Emerging antibody technologies offer promising approaches to overcome current limitations in studying BHMT and BHMT2 interactions:

• Recombinant antibody engineering:

  • Development of single-chain variable fragments (scFv) or nanobodies against specific epitopes of BHMT and BHMT2

  • Engineering bispecific antibodies that simultaneously recognize both BHMT and BHMT2

  • Creation of intrabodies that can detect protein interactions in living cells

• Proximity-dependent labeling approaches:

  • Conjugating BHMT antibodies with enzymes like HRP, BioID, or APEX2 for proximity-dependent biotinylation

  • Identifying proteins that interact with BHMT in their native cellular context

  • Mapping the spatial organization of BHMT and BHMT2 within specific cellular compartments

• Advanced microscopy applications:

  • Implementing super-resolution microscopy techniques (STORM, PALM, SIM) with BHMT antibodies

  • Using Förster resonance energy transfer (FRET) between differentially labeled BHMT and BHMT2 antibodies to detect close interactions

  • Applying live-cell imaging techniques with cell-permeable antibody fragments to monitor dynamic interactions

• Stabilization strategies for BHMT2:

  • Developing antibodies that recognize and stabilize BHMT2 in its native conformation

  • Creating fusion constructs with stability-enhancing tags that don't interfere with antibody recognition

  • Engineering conditional stabilization systems for BHMT2 that can be modulated experimentally

• Mass spectrometry integration:

  • Combining antibody-based purification with cross-linking mass spectrometry (XL-MS) to map interaction interfaces

  • Developing selective reaction monitoring assays with antibody-based enrichment to improve detection sensitivity

  • Applying hydrogen-deuterium exchange mass spectrometry to samples immunoprecipitated with BHMT antibodies

These technological advances could help overcome the significant challenges in studying BHMT2, which has proven difficult to express in mammalian cells, tends to aggregate after bacterial expression, and is rapidly degraded in experimental systems . The development of strategies that leverage the observed stabilization of BHMT2 by homocysteine and its interaction with BHMT would be particularly valuable for advancing our understanding of these closely related enzymes and their coordinated functions in homocysteine metabolism.

What are the key considerations for researchers selecting BHMT antibodies for their specific research questions?

When selecting BHMT antibodies for specific research applications, researchers should consider several critical factors to ensure experimental success:

• Experimental application compatibility:

  • Verify that the antibody has been validated for your specific application (WB, IHC, IP, ELISA, etc.)

  • Review published literature using the antibody in similar applications to assess performance

  • Consider whether monoclonal or polyclonal antibodies are more appropriate for your research question (polyclonals may offer higher sensitivity but potentially lower specificity)

• Species reactivity requirements:

  • Confirm that the antibody has been validated in your species of interest

  • For cross-species applications, prioritize antibodies raised against highly conserved epitopes

  • When working with less common species, consider custom validation studies prior to large-scale experiments

• Epitope characteristics:

  • For studying BHMT-BHMT2 interactions, select antibodies that recognize unique epitopes of each protein

  • For detecting post-translational modifications, ensure the epitope doesn't contain potential modification sites

  • For distinguishing among BHMT variants, choose antibodies that recognize regions containing polymorphisms of interest

• Technical specifications:

  • Review antibody formulation and storage requirements to ensure compatibility with your laboratory procedures

  • Consider conjugated antibodies for applications requiring direct detection without secondary antibodies

  • Assess concentration and volume to ensure sufficient material for planned experiments

• Validation documentation:

  • Prioritize antibodies with comprehensive validation data including positive and negative controls

  • Look for evidence of specificity testing such as knockdown/knockout validation

  • Consider the range of validated applications and whether they align with your experimental needs

• Reproducibility considerations:

  • For long-term studies, select antibodies from established manufacturers with consistent production methods

  • Document lot numbers and perform lot-to-lot validation for critical experiments

  • Consider recombinant antibodies for applications requiring exceptional reproducibility

By systematically evaluating these factors, researchers can select BHMT antibodies that offer the highest probability of successful experimental outcomes while minimizing artifacts and non-specific signals that could complicate data interpretation.

How does the current state of BHMT antibody research inform our understanding of homocysteine metabolism disorders?

The development and application of BHMT antibodies have significantly advanced our understanding of homocysteine metabolism disorders through multiple research avenues:

• Protective mechanisms elucidation:

  • BHMT antibody-based studies have demonstrated that BHMT protects hepatocytes from homocysteine-induced injury and lipid accumulation

  • These findings provide mechanistic insights into how BHMT expression levels may influence susceptibility to hyperhomocysteinemia-related pathologies

  • The protective effect of BHMT against lipid accumulation suggests potential therapeutic approaches for conditions characterized by both elevated homocysteine and hepatic steatosis

• Tissue-specific expression patterns:

  • Immunohistochemical studies using BHMT antibodies have mapped the enzyme's distribution beyond the canonical liver and kidney locations

  • This expanded expression profile helps explain tissue-specific vulnerabilities to homocysteine-related damage

  • The identification of BHMT in various tissues provides context for understanding the systemic effects of homocysteine metabolism disorders

• Genetic variation implications:

  • Antibody-based functional studies of BHMT variant allozymes have characterized how polymorphisms affect enzyme activity and stability

  • These findings help explain individual differences in homocysteine metabolism and susceptibility to related disorders

  • The correlation between genetic variants and functional outcomes provides potential biomarkers for personalized medicine approaches

• BHMT-BHMT2 interaction insights:

  • Co-immunoprecipitation studies have revealed potential functional interactions between BHMT and BHMT2

  • This interaction suggests coordinated roles in homocysteine metabolism and possible compensatory mechanisms

  • The stabilization of BHMT2 by BHMT provides insight into the regulation of these enzymes under various metabolic conditions

• Measurement standardization:

  • The development of quantitative ELISA methods using BHMT antibodies enables precise measurement of enzyme levels

  • Standardized measurement approaches facilitate comparison across studies and populations

  • Quantitative assessment of BHMT levels in relation to metabolic parameters advances our understanding of enzyme regulation in health and disease