BLVRA Human
Description
Biochemical Characterization of BLVRA
BLVRA (UniProt P53004) is a 33.3 kDa protein with a Rossmann fold structure containing a six-stranded β-sheet flanked by α-helices. It catalyzes the reduction of biliverdin IXα to bilirubin IXα, a reaction coupled to NADPH/NADH oxidation. Key features include:
-
Dual cofactor specificity: NADPH (pH 8.5–8.7) and NADH (pH 6.7–6.9) .
-
Protein kinase activity: Dual Ser/Thr and Tyr kinase functions .
Table 1: Enzyme Activity Parameters
Catalytic Mechanism and Substrate Specificity
BLVRA reduces biliverdin IXα by targeting the γ-methene bridge, converting it to bilirubin IXα. This reaction is pH-dependent and involves distinct cofactor usage:
Table 2: BLVRA vs. BLVRB Substrate Specificity
| Isoform | Substrate Preference | Pathway Role |
|---|---|---|
| BLVRA | Biliverdin IXα (95–97% adult) | Primary bilirubin IXα production |
| BLVRB | Biliverdin IXγ/IXδ/IXβ | Minor isomer reduction |
Tissue Distribution and Expression Regulation
BLVRA is highly expressed in the liver but detected in most tissues. Its expression is modulated by:
-
Hypoxia/Cytokines: Regulated by NF-κB and HIF-1 transcription factors .
-
Disease States: Elevated in hepatocellular carcinoma (via Wnt/β-catenin) and HCV-infected liver .
Key Findings:
-
HCV Infection: BLVRA mRNA levels in peripheral blood correlate with liver tissue levels (r² = 0.347, p = 0.03) and predict sustained virological response to antiviral therapy .
-
Cellular Senescence: BLVRA depletion in young fibroblasts increases ROS levels >3-fold and induces G₀-G₁ arrest via p16/p53/p21 upregulation .
Functional Roles Beyond Catalysis
BLVRA exhibits non-enzymatic roles critical to cellular homeostasis:
-
Antioxidant Regulation: Maintains the biliverdin/bilirubin redox cycle to neutralize ROS .
-
Signaling Pathways: Activates ERK and PKC-βII, modulating apoptosis and proliferation .
-
Transcriptional Control: Regulates heme oxygenase-1 (HO-1) expression and IGF-1/MAPK signaling .
Clinical and Therapeutic Implications
Emerging evidence links BLVRA to:
-
Liver Diseases: Elevated expression in HCV and hepatocellular carcinoma .
-
Metabolic Disorders: Potential role in diabetes pathogenesis via glucose metabolism regulation .
-
Aging: Loss of BLVRA function correlates with increased oxidative stress and senescence in aged cells .
Experimental Models and Assays
BLVRA activity is quantified via spectrophotometric assays measuring bilirubin production:
Product Specs
ELSLVSATLE ERKEDQYMKM TVCLETEKKS PLSWIEEKGP GLKRNRYLSF HFKSGSLENV PNVGVNKNIF LKDQNIFVQK LLGQFSEKEL AAEKKRILHC LGLAEEIQKY CCSRK.
Q&A
How is the human BLVRA gene structured and regulated?
The human BLVRA gene contains multiple regulatory elements in its promoter region. Researchers have identified functional NF-κB and HIF-1 regulatory elements within the promoter sequence . The promoter can be cloned using PCR with specific primers such as hBVR-836 (CCGCTAGCCAAGCCTTCTCTCTTTGCACTC) and hBVR-flank (CGGCTCGAGATCCCAGCTCCGATTGGC) . Transcriptional regulation of BLVRA appears to respond to cellular stress conditions, particularly oxidative stress. For experimental characterization of the promoter, researchers typically clone it into reporter vectors like pGL3-basic between NheI and XhoI restriction sites to study its activity under various conditions .
What evidence links BLVRA to cellular senescence and aging?
Multiple studies have established a significant relationship between BLVRA and cellular senescence. In human diploid fibroblasts (HDFs), H₂O₂ treatment markedly induces BLVRA activity in young cells, but this response is diminished in senescent cells . This differential response suggests an age-dependent modulation of oxidative stress reactions. More direct evidence comes from lentiviral RNAi experiments, where stable primary HDFs with reduced BLVRA expression demonstrated upregulation of CDK inhibitors p16, p53, and p21, followed by cell cycle arrest in G₀-G₁ phase and increased expression of senescence-associated β-galactosidase . These findings strongly indicate that BLVRA contributes to modulating the aging process by regulating cellular oxidative status .
How does BLVRA expression correlate with extreme longevity in humans?
Recent studies of supercentenarians (individuals living beyond 110 years) have identified potential connections between BLVRA levels and exceptional longevity. Research has shown that low levels of BLVRA in whole blood appear in supercentenarians, though the exact mechanism through which this contributes to longevity remains to be fully explored . The correlation suggests that BLVRA's role in modulating redox status may influence the aging trajectory. Importantly, research indicates that supercentenarians also exhibit a lower prevalence of somatic mutations in genes involved in hematopoietic malignancies, suggesting that longevity requires both specific genetic signatures in DNA repair mechanisms and controlled clonal hematopoiesis .
What are the optimal protocols for measuring BLVRA activity in biological samples?
When measuring BLVRA activity, researchers typically employ spectrophotometric assays that monitor the NADPH-dependent conversion of biliverdin to bilirubin. A standard protocol involves:
-
Preparation of assay buffer (100 mM Tris, pH 8.5)
-
Dilution of recombinant BLVRA to 3 ng/μL in assay buffer
-
Dilution of BSA to 3 mg/mL in assay buffer
-
Dilution of biliverdin to 60 μM in assay buffer
-
Combination of equal volumes of diluted BLVRA, BSA, and biliverdin to form the reaction mixture
-
Dilution of β-NADPH to 200 μM in assay buffer
For control reactions, assay buffer can be used in place of BLVRA. The reaction is typically performed in 96-well clear plates and measured using a plate reader such as SpectraMax Plus or equivalent .
What genetic models are available for studying BLVRA deficiency?
Researchers have established several genetic models to study BLVRA deficiency:
-
Blvra^-/-^ knockout mice: These models have been instrumental in understanding BLVRA's role in vivo. They display increased intracellular biliverdin concentration, which enhances the fluorescence intensity of near-infrared fluorescent proteins that require biliverdin as a chromophore .
-
Lentiviral RNAi-transfected stable primary HDFs: This in vitro model with reduced BLVRA expression has been used to demonstrate the role of BLVRA in cellular senescence .
-
CRISPR-Cas9 engineered cell lines: Although not explicitly mentioned in the search results, modern research often employs CRISPR-Cas9 technology to create cell lines with BLVRA knockout or specific mutations.
When working with these models, researchers should monitor changes in oxidative stress markers, senescence indicators (p16, p53, p21), cell cycle progression, and senescence-associated β-galactosidase activity .
How does BLVRA contribute to cellular protection against oxidative stress?
BLVRA plays a crucial role in cellular defense against oxidative stress through multiple mechanisms:
-
Direct antioxidant activity: By catalyzing the conversion of biliverdin to bilirubin, BLVRA contributes to the bilirubin-biliverdin redox cycle, which has potent antioxidant properties .
-
Differential response in young vs. senescent cells: H₂O₂ markedly induces BLVRA activity in young human diploid fibroblasts but not in senescent cells, suggesting age-dependent modulation of responses to oxidative stress .
-
Regulation of stress response genes: BLVRA depletion reduces the H₂O₂-dependent induction of heme oxygenase-1 (HO-1) in young cells but not in senescent cells, indicating its role in orchestrating broader stress response pathways .
For experimental investigation of these mechanisms, researchers typically employ oxidative stress inducers like H₂O₂ at sub-lethal concentrations and monitor changes in BLVRA activity, expression of stress response genes, and markers of cellular damage.
What is the relationship between BLVRA and other stress response pathways?
BLVRA functions within a complex network of stress response pathways:
-
Heme oxygenase-1 (HO-1) pathway: BLVRA activity influences HO-1 induction in response to oxidative stress, with BLVRA depletion reducing H₂O₂-dependent induction of HO-1 in young cells .
-
NF-κB signaling: The BLVRA promoter contains NF-κB regulatory elements, and biliverdin (the substrate of BLVRA) is known to inhibit NF-κB, suggesting a feedback regulatory mechanism .
-
HIF-1 pathway: The presence of HIF-1 regulatory elements in the BLVRA promoter indicates potential regulation under hypoxic conditions .
To study these interactions, researchers can use promoter-reporter assays, chromatin immunoprecipitation, and co-immunoprecipitation techniques to identify protein-protein interactions within these pathways.
How can manipulation of BLVRA activity enhance fluorescent protein research?
BLVRA manipulation has significant implications for near-infrared (NIR) fluorescent protein research:
-
Enhanced fluorescence intensity: BLVRA deficiency increases intracellular biliverdin concentration, which enhances the fluorescence intensity of NIR fluorescent proteins that require biliverdin as a chromophore. In Blvra^-/-^ mice, iRFP fluorescence intensity was significantly increased in all examined tissues .
-
Improved calcium indicators: The genetically encoded calcium indicator NIR-GECO1, engineered based on another NIR fluorescent protein (mIFP), exhibits marked increases in fluorescence intensity in mouse embryonic fibroblasts derived from Blvra^-/-^ mice .
-
Enhanced optogenetic tools: The NIR light-sensing BphP1-PpsR2 system, which requires biliverdin as a chromophore, shows markedly enhanced light response in cells with BLVRA deletion .
These findings suggest that Blvra^-/-^ mice and cell lines represent versatile tools for in vivo applications of NIR fluorescent proteins and NIR light-sensing optogenetic tools.
What are the contradictions and unresolved questions in BLVRA research?
Several important questions remain unresolved in BLVRA research:
-
Mechanism of longevity contribution: How low levels of BLVRA in whole blood of supercentenarians exactly contribute to longevity remains to be explored .
-
Tissue-specific functions: BLVRA may have different roles depending on tissue type, but comprehensive studies of tissue-specific functions are lacking.
-
Interaction with genetic factors: While genetic variability influences extreme longevity, the interaction between BLVRA and other genetic factors in determining lifespan needs further investigation. Studies suggest that individuals surviving to age 105 have a 35 times greater chance of having siblings reaching the same age , but the specific contribution of BLVRA to this genetic component remains unclear.
-
Regulatory mechanisms: Further research is needed to fully characterize the complex transcriptional and post-translational regulation of BLVRA under various physiological and pathological conditions.
To address these questions, researchers should consider comprehensive multi-omics approaches, longitudinal studies of aging populations, and advanced genetic models with tissue-specific modulation of BLVRA expression.
Product Science Overview
The breakdown of heme, a component of hemoglobin, is a two-step process. First, heme oxygenase catalyzes the conversion of heme to biliverdin. This reaction involves the cleavage of the heme ring at the alpha-methene bridge, producing biliverdin IXα, carbon monoxide, and free iron . Biliverdin is then reduced to bilirubin by biliverdin reductase A, utilizing NADPH as a cofactor .
Biliverdin Reductase A is a multifunctional enzyme with a wide range of biological activities. It is known for its role in converting biliverdin to bilirubin, but it also has kinase activity and can function as a transcription factor . The enzyme has two distinct cofactor-dependent pH optima: in the acidic range (pH 6.0-6.7), it utilizes NADH, while in the alkaline range (pH 8.5-8.7), it utilizes NADPH .
The recombinant form of Biliverdin Reductase A is produced using Escherichia coli expression systems. This method allows for the scalable production of the enzyme, ensuring high purity and activity . The recombinant enzyme is typically expressed in a buffered aqueous solution and can be stored at -20°C .
Biliverdin Reductase A is considered a major physiological cytoprotectant. It has been shown to suppress experimental autoimmune encephalomyelitis in rats, indicating its potential role in modulating immune responses . Depletion of this enzyme leads to the accumulation of cellular oxidants and increased cell death, highlighting its importance in cellular protection .
The ability of Biliverdin Reductase A to convert biliverdin to bilirubin, a potent antioxidant, suggests its potential as a therapeutic agent. The enzyme’s role in redox homeostasis and its protective effects against oxidative stress make it a promising candidate for the treatment of various diseases, including neurodegenerative disorders and inflammatory conditions .
