BTF3L4 Human

What is BTF3L4 and what are its key structural features?

BTF3L4 (Basic Transcription Factor 3 Like 4) is a 158 amino acid protein that belongs to the NAC-beta family. It contains one NAC-A/B (NAC-alpha/beta) domain, which is critical for its biological functions . The protein has a molecular mass of approximately 11.3kDa in its recombinant form . Structurally, BTF3L4 shares homology with other members of the NAC-beta family, containing conserved regions that facilitate its interactions with nascent polypeptide chains and transcription machinery .

Methodology for structural analysis typically employs:

• X-ray crystallography or NMR spectroscopy to resolve three-dimensional structure

• Sequence alignment tools to identify conserved domains

• Computational modeling to predict protein-protein interaction interfaces

What are the primary cellular functions of BTF3L4?

BTF3L4 serves multiple cellular functions:

• Transcriptional regulation: Required for the initiation of transcription, forming stable complexes with RNA polymerase II .

• Co-translational processing: Binds to polypeptide chains as they emerge from ribosomes, preventing inappropriate interaction with the signal recognition particle (SRP) .

• Protein targeting regulation: Reduces the affinity of ribosomes for protein translocation sites in the endoplasmic reticulum membrane .

These functions position BTF3L4 as an important regulator at the interface of transcription and translation, potentially coordinating these processes in specific cellular contexts.

What are optimal protocols for BTF3L4 overexpression in cellular models?

For effective BTF3L4 overexpression:

• Vector selection: Lentiviral vectors provide efficient delivery and stable expression for long-term studies .

• Transfection approach:

  • For transient expression: Lipofectamine 3000 transfection reagent delivers high efficiency in most cell lines .

  • For stable expression: Lentiviral transduction followed by appropriate selection marker screening.

• Validation methods:

  • RT-qPCR using specific primers (e.g., Mouse BTF3L4 forward, 5′-AGAAGGTGGTACATAGGACAGC-3′; Mouse BTF3L4 reverse, 5′-CCGTGCCATCGTCTTTAATCAT-3′) .

  • Western blotting using commercially available antibodies (e.g., anti-BTF3L4, ab128870) .

• Controls: Include empty vector controls and wild-type cells for accurate assessment of overexpression effects.

What approaches are most effective for BTF3L4 knockdown studies?

For optimal BTF3L4 knockdown:

• shRNA design: Multiple target sequences should be tested, such as:

  • Mouse BTF3L4 shRNA1: GCACGGTTATTCATTTCAACA

  • Mouse BTF3L4 shRNA2: GCTAACACCTTTGCAATTACT

  • Mouse BTF3L4 shRNA3: GCTTGGTGCTGACAGCTTAAC

• Delivery method:

  • Lentiviral vectors for stable knockdown

  • Transfection with Lipofectamine 3000 for transient knockdown

• Validation:

  • qPCR to confirm reduced mRNA levels

  • Western blotting to verify protein reduction

  • Functional assays to assess phenotypic effects

• Controls:

  • Non-targeting shRNA (shNC) essential for distinguishing specific effects from off-target effects

  • Wild-type cells without any manipulation

How does BTF3L4 contribute to acetaminophen-induced liver injury?

BTF3L4 plays a crucial role in acetaminophen (APAP)-induced liver injury through several mechanisms:

• Mitochondrial dysfunction:

  • BTF3L4 overexpression damages mitochondrial morphology and function

  • This triggers cascade events including reactive oxygen species (ROS) accumulation and oxidative stress

• Apoptosis induction:

  • Increased BTF3L4 expression enhances apoptotic signaling pathways

  • This leads to increased cell death in hepatic tissues

• Inflammatory response:

  • BTF3L4 upregulates pro-inflammatory cytokines including IL-1β and TNF-α

  • Expression correlates positively with inflammatory markers

Experimental evidence shows that BTF3L4 was the only outlier transcription factor overexpressed in AILI mouse models, and its overexpression significantly increased the degree of liver injury .

What experimental models are most appropriate for studying BTF3L4 in liver injury?

Two complementary models are recommended:

In vivo model:

• APAP-induced acute liver injury mouse model:

  • Protocol: Overnight fasting (12h) followed by intraperitoneal injection of 300 mg/kg APAP

  • Sampling: Blood and liver collection at 6, 24, and 48h post-administration

  • Analysis: Histopathology, biochemical markers, gene/protein expression

In vitro model:

• AML-12 mouse hepatocyte cell line:

  • BTF3L4 manipulation: Overexpression using adenoviral vectors (Ad-BTF3L4) or knockdown using shRNA

  • APAP exposure: Treat cells with physiologically relevant APAP concentrations

  • Endpoints: Cell viability, ROS production, mitochondrial function, inflammatory markers

Both models should include appropriate controls and employ multiple experimental techniques to comprehensively assess BTF3L4's role.

What is known about BTF3L4's role in glioma progression?

Recent research reveals BTF3L4 as a significant factor in glioma pathogenesis:

• Expression pattern:

  • Higher BTF3L4 expression in glioma tissues compared to non-tumor brain tissues

  • Expression levels correlate with clinical characteristics and potentially prognosis

• Functional effects:

  • Enhances malignant phenotypes in glioma cells

  • Modulates both tumor cell function and the immune microenvironment

These findings suggest BTF3L4 could serve as both a prognostic biomarker and potential therapeutic target in glioma. Research methods typically involve immunohistochemical analysis of patient samples, correlation with clinical data, and functional studies in glioma cell lines and animal models.

How do researchers investigate BTF3L4's molecular interactions in cancer contexts?

Multiple complementary approaches are employed:

• Protein-protein interaction studies:

  • Co-immunoprecipitation to identify direct binding partners

  • Proximity labeling techniques (BioID) to map spatial interactions

  • Mass spectrometry to identify novel interactors

• Functional genomics:

  • CRISPR-Cas9 screens to identify synthetic lethal interactions

  • RNA-seq to determine transcriptional effects of BTF3L4 manipulation

• Signaling pathway analysis:

  • Phosphoproteomics to identify altered signaling cascades

  • Reporter assays to assess effects on specific pathways

• In silico analysis:

  • Network-based approaches using STRING database reveals interactions with NACA, NACA2, NACAD, and various nucleoporins (NUP93, NUP205, NUP155)

What is known about BTF3L4's protein interaction network?

BTF3L4 exhibits a distinct protein interaction network focused on nascent polypeptide processing and nuclear pore complexes:

These interactions suggest BTF3L4 functions in coordinating protein synthesis, quality control, and nuclear transport pathways .

Research approaches to further explore this network include:

• Affinity purification coupled with mass spectrometry

• Yeast two-hybrid screening

• Proximity labeling techniques (BioID/APEX)

• Co-immunoprecipitation with validation by Western blotting

How does BTF3L4 regulate oxidative stress pathways?

BTF3L4 modulates oxidative stress through several mechanisms:

• Mitochondrial function impairment:

  • BTF3L4 overexpression damages mitochondrial morphology

  • This leads to electron transport chain dysfunction and increased ROS leakage

• ROS accumulation:

  • Enhanced reactive oxygen species generation

  • Decreased cellular antioxidant capacity

• Oxidative damage cascade:

  • Lipid peroxidation

  • Protein oxidation

  • DNA damage

Methodological approaches to study these effects include:

• Measurement of ROS using fluorescent probes (DCFDA, MitoSOX)

• Assessment of mitochondrial membrane potential

• Quantification of oxidative damage markers (8-OHdG, malondialdehyde)

• Analysis of antioxidant enzyme activities (SOD, catalase, GPx)

What are the challenges in developing BTF3L4 as a diagnostic biomarker for liver injury?

Developing BTF3L4 as a diagnostic biomarker faces several challenges requiring methodological solutions:

• Assay development challenges:

  • Need for sensitive detection methods (ELISA, immunoassays)

  • Standardization across different testing platforms

  • Establishing reference ranges across diverse populations

• Biological variability:

  • Determining baseline expression in healthy individuals

  • Understanding effects of comorbidities and medications

  • Accounting for genetic variation affecting expression

• Clinical validation requirements:

  • Large-scale prospective studies comparing BTF3L4 to established markers

  • Determination of sensitivity, specificity, positive/negative predictive values

  • Assessment of leadtime advantage over existing markers

• Analytical considerations:

  • Protein stability in clinical samples

  • Pre-analytical variables affecting measurement

  • Need for point-of-care testing development

Research suggests BTF3L4 has potential as a novel biomarker for AILI due to its specific overexpression and correlation with disease severity , but these challenges must be addressed through rigorous validation studies.

What therapeutic opportunities might emerge from targeting BTF3L4 pathways?

Several therapeutic strategies could emerge from targeting BTF3L4:

• Direct inhibition approaches:

  • Small molecule inhibitors of BTF3L4 protein-protein interactions

  • Antisense oligonucleotides or siRNA to reduce expression

  • PROTAC-based targeted protein degradation

• Pathway modulation:

  • Targeting downstream effectors in inflammatory cascades

  • Mitochondrial protective agents to counteract BTF3L4-induced dysfunction

  • Antioxidant therapies to mitigate ROS accumulation

• Precision medicine applications:

  • Stratification of patients based on BTF3L4 expression levels

  • Combination therapies targeting BTF3L4 alongside standard treatments

  • Biomarker-guided therapy selection

Current evidence from liver injury and glioma studies suggests targeting BTF3L4 could reduce tissue damage in APAP overdose and potentially inhibit cancer progression in BTF3L4-overexpressing tumors . Development would require target validation, phenotypic screening, lead optimization, and extensive preclinical testing.

How conserved is BTF3L4 across species and what does this suggest about its function?

BTF3L4 demonstrates notable evolutionary conservation, providing insights into its fundamental biological roles:

• Zebrafish homolog:

  • Zebrafish btf3l4 (ZDB-GENE-040426-1650) shows significant homology to human BTF3L4

  • Conserved domain structure including the NAC-A/B domain

  • Multiple transcript variants identified (btf3l4-201, btf3l4-202, btf3l4-203, btf3l4-204)

• Functional domain conservation:

  • NAC-A/B domain superfamily

  • Nascent polypeptide-associated complex NAC domain

  • Transcription factor BTF3 domain

This conservation suggests BTF3L4 plays fundamental roles in:

• Transcriptional regulation that predates vertebrate evolution

• Essential co-translational processing functions

• Core protein quality control mechanisms

Research approaches to leverage this conservation include:

• Cross-species functional complementation studies

• Evolutionary rate analysis of protein domains

• Model organism studies (zebrafish, mice) with translational relevance to human biology

What are best practices for handling recombinant BTF3L4 protein in experimental settings?

When working with recombinant BTF3L4:

• Storage considerations:

  • Store at 4°C if using within 2-4 weeks

  • For longer storage, maintain at -20°C

  • Add carrier protein (0.1% HSA or BSA) for long-term stability

  • Avoid repeated freeze-thaw cycles

• Buffer optimization:

  • Standard preparation: 20mM Tris-HCl buffer (pH 8.0) with 10% glycerol and 0.4M Urea

  • Protein concentration typically maintained at 1mg/ml

• Experimental handling:

  • Thaw on ice immediately before use

  • Centrifuge briefly before opening to collect solution at bottom

  • Use sterile techniques to prevent contamination

• Quality control:

  • Verify purity by SDS-PAGE (should be >85%)

  • Confirm identity by Western blot or mass spectrometry

  • Test functional activity through appropriate binding assays

These practices ensure experimental reliability and reproducibility when working with recombinant BTF3L4 protein.

What are the most sensitive detection methods for BTF3L4 in experimental and clinical samples?

Several detection methods offer varying sensitivity and specificity profiles:

• Immunodetection methods:

  • Western blotting: Sensitive for denatured protein in experimental samples

    • Recommended antibody: anti-BTF3L4 (ab128870)

  • Immunohistochemistry: For tissue localization studies

    • Requires antigen retrieval in formalin-fixed, paraffin-embedded tissues

  • ELISA: For quantitative measurement in serum or tissue lysates

• Nucleic acid-based detection:

  • RT-qPCR: Highly sensitive for mRNA quantification

    • Recommended primers provided in previous sections

  • In situ hybridization: For spatial expression analysis in tissues

• Proteomics approaches:

  • Targeted mass spectrometry (MRM/PRM)

  • Proximity extension assays

  • Protein arrays

• Emerging technologies:

  • Digital ELISA (Simoa) for ultra-sensitive detection

  • Aptamer-based detection systems

  • CRISPR-based diagnostics