CACYBP Antibody

What is CACYBP and why is it important in research?

CACYBP (Calcyclin-binding protein) is a multi-ligand protein of 26-30 kDa that interacts with S100 proteins, including S100A6, S100A1, S100B, and S100P. It plays critical roles in calcium-dependent ubiquitination and subsequent proteasomal degradation of target proteins, serving as a molecular bridge in ubiquitin E3 complexes . It participates in the ubiquitin-mediated degradation of beta-catenin (CTNNB1) .

Recent studies have revealed that CACYBP possesses phosphatase activity and can bind and dephosphorylate Erk1/2 . Its significance in cancer research has grown substantially, with CACYBP identified as a novel prognostic and predictive marker for multiple human cancers .

For optimal performance and longevity of CACYBP antibodies:

• Store at -20°C in appropriate storage buffer (typically PBS with 0.02% sodium azide and 50% glycerol, pH 7.3)

• Antibodies are generally stable for one year after shipment when stored properly

• For fluorescently conjugated antibodies, avoid exposure to light to prevent photobleaching

• Aliquoting is often unnecessary for -20°C storage

• Before use, gently mix the antibody solution - avoid vigorous shaking or vortexing

• For CoraLite® Plus 488-conjugated antibodies, note the excitation/emission maxima are 493 nm/522 nm

How can I optimize CACYBP detection in low-expression samples?

Detecting CACYBP in samples with low expression requires methodological optimizations:

For Western Blotting:

• Increase protein loading (up to 50-100 μg)

• Use enhanced chemiluminescence substrates for greater sensitivity

• Extend primary antibody incubation (overnight at 4°C)

• Consider more concentrated antibody solutions (1:500-1:1000)

• Use PVDF membranes for better protein retention

For Immunohistochemistry:

• Compare heat-mediated antigen retrieval methods:

  • Citrate buffer (pH 6.0)

  • TE buffer (pH 9.0)

• Optimize blocking conditions (10% normal goat serum has been effective)

• Extend DAB substrate development time while monitoring background

• Use amplification systems for signal enhancement

For Flow Cytometry:

• Increase permeabilization efficiency for intracellular staining

• Use higher antibody concentrations (0.40 μg per 10^6 cells)

• Select fluorophores with higher quantum yield

How do CACYBP expression patterns differ across cancer types?

CACYBP exhibits remarkable variability in expression across cancer types, making it an important research target:

• Upregulated in 14 cancer types including:

  • Breast invasive carcinoma

  • Lung adenocarcinoma (experimentally validated by Western blot)

• Downregulated in 6 cancer types including:

  • Glioblastoma multiforme

• Prognostic significance in 13 cancers including:

  • Adrenocortical carcinoma

  • Hepatocellular carcinoma (HCC) - high expression associated with poor prognosis

• Diagnostic potential:

  • Distinguishes 15 cancer types from normal tissues with high accuracy (AUC > 0.8)

  • Notable diagnostic marker for cholangiocarcinoma

• Correlation with cancer characteristics:

  • Positively correlated with tumor mutational burden in multiple cancers (BLCA, HNSCC, LUAD, PAAD, SARC, STAD, THYM, and UCEC)

  • Associated with microsatellite instability in UCEC (positive) and DLBC (negative)

  • CACYBP overexpression in HCC stimulates phosphorylation of P27Kip1 at Ser10, Thr157, and Thr198, promoting its cytoplasmic retention

What protocols have been validated for CACYBP immunohistochemistry in clinical samples?

Researchers have established effective protocols for CACYBP immunohistochemistry in clinical specimens:

• Sample preparation:

  • Paraffin-embedded tissues sectioned at 4-μm thickness

  • Overnight drying at 37°C

  • Deparaffinization in xylene (twice for 10 min)

  • Rehydration through graded alcohol (five times for 5 min)

  • Hydrogen peroxide (3%) treatment for 15 min to block endogenous peroxidase

• Antigen retrieval:

  • Electric pressure cooker method using EDTA buffer (pH 8.0) for 3 min

  • Alternative methods: citrate buffer (pH 6.0) or TE buffer (pH 9.0)

• Blocking and antibody incubation:

  • Block with 10% normal goat serum at room temperature for 30 min

  • Incubate with primary anti-CACYBP antibody overnight at 4°C

  • Incubate with anti-rabbit secondary antibody at room temperature for 1 hour

• Signal development and evaluation:

  • Develop signal with freshly prepared DAB substrate solution for 5 min

  • Counterstain with Mayer's hematoxylin

  • Evaluate based on staining intensity scores (0-3) and expression extent scores (1-4)

  • Final expression score = intensity score × extent score

• Scoring system validation:

  • CACYBP high expression threshold established at >7.5 using ROC curve analysis

  • RNF41 (a CACYBP interaction partner) high expression threshold set at >5.5

How can I validate the specificity of my CACYBP antibody?

Thorough validation ensures reliable experimental results with CACYBP antibodies:

• Western blot validation:

  • Confirm detection of bands at the expected molecular weight (26-30 kDa)

  • Use positive control samples known to express CACYBP:

    • Human: HeLa cells, MCF7, 293T, PC3 cells

    • Mouse: brain tissue, liver tissue

    • Rat: brain tissue, liver tissue

• Genetic validation:

  • Compare antibody signal between wild-type and CACYBP knockdown samples

  • Validated shRNA sequences for CACYBP knockdown:

    • shCACYBP#1: 5'-GATATGAAGCGAACCATTAAT-3'

    • shCACYBP#2: 5'-AAGAGTTACTCCATGATTGTG-3'

• Cross-platform validation:

  • Verify consistent detection across multiple applications (WB, IHC, IF)

  • Compare antibody performance in different sample types (cell lines vs. tissues)

• Multi-antibody approach:

  • Use multiple antibodies targeting different CACYBP epitopes

  • Both polyclonal and monoclonal options are available

  • Compare results from different antibody clones (e.g., EPR12374, D43G11)

• Protein interaction validation:

  • Confirm detection of known CACYBP interactions (e.g., with SKP1 or RNF41)

  • Proximity ligation assay can visualize protein-protein interactions

What methods are effective for studying CACYBP protein-protein interactions?

Several validated approaches have yielded significant insights into CACYBP interaction networks:

• Proximity Ligation Assay (PLA):

  • Enables visualization of protein interactions in situ with single-molecule resolution

  • Successfully used to detect CACYBP-SKP1 interactions in HeLa cells

  • Protocol details: anti-SKP1 rabbit polyclonal (1:1200) + anti-CACYBP mouse monoclonal (1:50)

  • Analysis performed using specialized software (BlobFinder)

• Immunoprecipitation approaches:

  • Co-immunoprecipitation confirmed interaction between CACYBP and RNF41 at both exogenous and endogenous levels

  • Various tagging strategies effective for detection:

    • Flag tag (GATTACAAGGATGACGACGATAAG)

    • HA tag (TACCCATACGATGTTCCAGATTACGCT)

    • Myc tag (GAACAGAAACTGATCTCTGAAGAAGACCTG)

    • 6×His tag (CATCATCACCATCACCAC)

• Domain mapping through mutational analysis:

  • CACYBP N-terminus mutant: deletion of amino acids 81-229

  • CACYBP C-terminus mutant: deletion of amino acids 1-73

  • RNF41 N-terminus mutant: deletion of amino acids 134-317

  • RNF41 C-terminus mutant: deletion of amino acids 1-133

• Advanced strategies:

  • Mass spectrometry following immunoprecipitation

  • Quantitative high-throughput LUMIER assays

  • SFB-tagged (S-protein-Flag-Streptavidin binding peptide) CACYBP for tandem affinity purification

What are the established protocols for studying CACYBP in ubiquitination pathways?

CACYBP's role in ubiquitin-mediated protein degradation can be investigated using these validated approaches:

• Ubiquitination assays:

  • Co-expression of CACYBP with RNF41 and ubiquitin in cell models

  • Immunoprecipitation followed by ubiquitin detection via Western blot

  • Proteasome inhibitors (MG132) and lysosome inhibitors to differentiate degradation pathways

• E3 ligase activity modulation:

  • PCR-based site-directed mutagenesis to generate E3 ligase-dead RNF41 mutant (D56V)

  • Comparison of wild-type vs. mutant effects on CACYBP stability and function

• Target protein phosphorylation analysis:

  • Evaluation of P27Kip1 phosphorylation at specific residues (Ser10, Thr157, Thr198)

  • Use of phosphomimetic mutants (S10A and S10D) to assess functional consequences

  • Effects on subcellular localization determined by immunofluorescence

• Functional consequences assessment:

  • Cell cycle analysis by flow cytometry

  • Apoptosis detection using flow cytometry

  • Western blot to assess levels of cell cycle regulators (cyclin D1, cyclin A2, CDK2, CDK4)

  • Colony formation assays to evaluate long-term proliferative capacity

How can I establish and validate CACYBP knockdown models?

Creating reliable CACYBP knockdown systems requires careful methodology:

• shRNA-mediated knockdown:

  • Validated shRNA sequences targeting CACYBP:

    • shCACYBP#1: 5'-GATATGAAGCGAACCATTAAT-3'

    • shCACYBP#2: 5'-AAGAGTTACTCCATGATTGTG-3'

  • Non-targeting control: 5'-CAACAAGATGAAGAGCACCAA-3'

  • Vector system: pLKO.1 (Sigma-Aldrich)

• Lentiviral delivery system:

  • Co-transfect constructed plasmids with packaging plasmids (psPAX2 and pMD2.G)

  • Collect viral supernatant after 48h, filter and concentrate

  • Add polybrene (8 μg/mL) during infection to enhance transduction

  • Select stable lines with puromycin (2 μg/mL) for 2 weeks

• Validation of knockdown efficiency:

  • Western blot to confirm protein reduction

  • qRT-PCR to verify mRNA reduction

  • Functional assays to demonstrate biological consequences

• Rescue experiments:

  • Re-expression of wild-type or mutant CACYBP to confirm phenotype specificity

  • Example: P27Kip1-S10D (but not P27Kip1-S10A) partially rescued cell cycle function after CACYBP depletion

• In vivo model validation:

  • Xenograft models with CACYBP-depleted cells

  • Monitoring of tumor growth, invasion, and metastasis

  • Immunohistochemical analysis of xenograft tissues

How does CACYBP function in different cellular compartments?

CACYBP exhibits dynamic subcellular distribution with context-dependent functions:

• Nuclear functions:

  • Retinoic acid treatment induces CACYBP translocation to the nucleus in neuroblastoma cells

  • Nuclear translocation correlates with CACYBP phosphorylation on serine residues

  • Regulates transcriptional responses in brain cells

• Cytoplasmic activities:

  • Enhances cytoplasmic retention of P27Kip1 to promote hepatocellular carcinoma progression

  • Stimulates phosphorylation of P27Kip1 at Ser10, Thr157, and Thr198

  • Interacts with cytoskeletal proteins (tubulin, actin) through specific domains

• Methodological approaches for compartment-specific analysis:

  • Subcellular fractionation followed by Western blot

  • Immunofluorescence with co-staining for compartment markers

  • Proximity ligation assay for visualizing interactions in specific compartments

  • Mutation of nuclear localization/export signals to manipulate localization

• Functional consequences of mislocalization:

  • CACYBP depletion leads to decreased levels of cell cycle regulators

  • Causes G1/S phase arrest and increased apoptosis in HCC cells

  • Differential effects on immune infiltration across cancer types

• Cancer-specific alterations:

  • Positive association with immune cells in ACC, KICH, KIRC, PRAD, and THCA

  • Negative correlation with immune, stromal, and estimate scores in LGG, LUSC, SARC, SKCM, TGCT, and UCEC

What are the best practices for troubleshooting inconsistent CACYBP immunodetection?

When facing challenges with CACYBP detection, systematic troubleshooting is essential:

• Antibody-specific optimization:

  • Test multiple anti-CACYBP antibodies targeting different epitopes

  • Compare monoclonal vs. polyclonal antibodies

  • Verify antibody integrity through dot blot against immunizing peptide

  • Consider antibody lot variation and storage conditions

• Application-specific adjustments:

  • Western blot: Optimize transfer conditions for 26-30 kDa range; test reducing/non-reducing conditions

  • IHC: Compare antigen retrieval methods (citrate buffer pH 6.0 vs. TE buffer pH 9.0)

  • IF: Test different fixation methods; optimize permeabilization conditions

  • Flow cytometry: Enhance permeabilization for intracellular staining

• Sample preparation considerations:

  • For tissue samples, control fixation time precisely

  • For cell lines, standardize growth conditions and harvest protocols

  • For brain tissue, use region-specific protocols as CACYBP expression varies across brain regions

• Signal enhancement strategies:

  • For WB: Use sensitive ECL substrates; increase exposure time

  • For IHC/IF: Try tyramide signal amplification systems

  • For low abundance samples: Consider enrichment through immunoprecipitation prior to detection

• Control experiments:

  • Include verified positive controls (HeLa cells, mouse brain tissue)

  • Use CACYBP knockdown samples as negative controls

  • Implement comprehensive experimental controls for each application