CAMK2G Antibody

What is CAMK2G and why is it an important research target?

CAMK2G (calcium/calmodulin-dependent protein kinase II gamma) is a member of the CAMK Ser/Thr protein kinase family that plays critical roles in cell differentiation and nervous system development. In humans, the canonical protein consists of 558 amino acid residues with a molecular mass of approximately 62.6 kDa and is primarily localized to the membrane . The protein is expressed predominantly in skeletal muscle, though it has wide distribution across various tissues. CAMK2G's importance as a research target stems from its involvement in neurodevelopment, with mutations linked to intellectual disability, making it relevant for neurobiology, developmental biology, and pathophysiological studies .

How many isoforms of CAMK2G exist and how do I ensure my antibody detects my isoform of interest?

Up to 11 different isoforms of CAMK2G have been reported . To ensure specificity for your isoform of interest, consider the following methodological approach:

• Determine the unique sequence regions of your target isoform

• Select antibodies that recognize epitopes specific to that isoform

• Perform validation experiments with positive controls (tissues/cells known to express your isoform) and negative controls (tissues/cells without expression)

• Consider using knockdown/knockout systems to verify specificity

• When purchasing, examine the immunogen information to determine which regions of CAMK2G the antibody targets

Many commercial antibodies can recognize multiple isoforms, with observed molecular weights ranging from 55-66 kDa . For isoform-specific detection, epitope-specific antibodies targeting unique regions are essential.

What are the common applications for CAMK2G antibodies in research?

CAMK2G antibodies are utilized across multiple experimental platforms with varying dilution requirements:

Over 400 citations in scientific literature describe the use of CAMK2G antibodies in research, with Western Blot being the most widely reported application .

How should I optimize Western blot conditions for CAMK2G detection?

For optimal Western blot detection of CAMK2G:

• Sample preparation: Use brain tissue (particularly rich in CAMK2G) or relevant cell lines such as SMMC-7721, PC-3, or HCT 116 cells as positive controls

• Loading amount: Start with 20-40 μg of total protein per lane

• Antibody selection: For general CAMK2G detection, validated antibodies like 12666-2-AP (polyclonal) have been extensively cited

• Antibody dilution: Begin with manufacturer's recommended range (typically 1:1000-1:4000 for polyclonal and 1:5000-1:50000 for monoclonal antibodies)

• Expected band pattern: Depending on the antibody, you may observe a triple band pattern representing different isoforms; knockout controls show the absence of specific bands

• Incubation conditions: Primary antibody incubation is typically optimal overnight at 4°C

• Blocking agent: 5% non-fat dry milk or BSA in TBST is generally effective

Remember to optimize for your specific tissue/cell type and experimental conditions.

What methodological considerations are important for immunohistochemistry with CAMK2G antibodies?

For successful immunohistochemical detection of CAMK2G:

What controls should I include when using CAMK2G antibodies to ensure reliability?

A comprehensive control strategy includes:

• Positive controls:

  • Tissues: Brain regions (cortex, hippocampus), skeletal muscle, heart tissue

  • Cell lines: SMMC-7721, PC-3, HepG2, and LNCaP cells

• Negative controls:

  • Primary antibody omission

  • Isotype controls matching the primary antibody host species

  • Ideally, Camk2g knockout tissues/cells as the gold standard

• Specificity controls:

  • Pre-adsorption with immunizing peptide where available

  • Multiple antibodies targeting different epitopes of CAMK2G

  • siRNA or shRNA knockdown of CAMK2G (three validated shRNA sequences: GCCCGAGATCATCAGAAACTA, CCTGAGGTCTTGAGGAAAGAT, and CTACGCAGGAATATGCTGCAA)

• Cross-reactivity assessment:

  • Note that due to sequence homology, some CAMK2G antibodies may cross-react with CAMK2A/B/D isoforms

  • Verify specificity across species if working with non-human models

How can I distinguish between different CAMK2G isoforms in my experimental system?

To differentiate between CAMK2G isoforms:

• Electrophoretic mobility: The different isoforms present distinct molecular weights (55-66 kDa range). Higher resolution SDS-PAGE (8-10%) can help separate these bands .

• Isoform-specific antibodies: Select antibodies targeting unique regions not conserved across isoforms. For example:

  • Antibodies targeting the C-terminal region (AA 322-481) are available for specific isoform detection

  • Multiple antibodies with different epitope targets can help confirm isoform identity

• RT-PCR: Complement protein detection with transcript analysis using isoform-specific primers

• Mass spectrometry: For definitive identification, use immunoprecipitation followed by mass spectrometry analysis

• Subcellular fractionation: Some isoforms show distinct subcellular localization. For example, certain CAMK2G isoforms target to the nucleus while others remain cytosolic .

What are the best approaches to study CAMK2G function in neuronal development and intellectual disability models?

Based on published methodologies, the following approaches are effective:

• Genetic manipulation:

  • shRNA knockdown using validated sequences (GCCCGAGATCATCAGAAACTA, CCTGAGGTCTTGAGGAAAGAT, or CTACGCAGGAATATGCTGCAA)

  • CRISPR/Cas9 targeting of specific domains or patient-derived mutations

  • Introduction of specific mutations (e.g., p.Arg292Pro) to study pathogenic mechanisms

• Functional assays:

  • Neuronal migration assays in vivo

  • Neuronal maturation assays in vitro

  • Analysis of dendritic complexity and spine morphology

  • Electrophysiological measurements of synaptic function

• Molecular analysis:

  • Phosphorylation-specific antibodies to assess kinase activity

  • Assessment of CAMK2G nuclear targeting using subcellular fractionation and immunofluorescence

  • Co-immunoprecipitation to identify interacting partners

• Behavioral assays:

  • Motor function assessment

  • Learning and memory tasks

  • Intrinsic behavioral analysis

How can I assess if a CAMK2G mutation affects protein function and localization?

To evaluate the impact of CAMK2G mutations on function and localization:

• Enzyme activity assays:

  • Measure phosphotransferase activity in vitro

  • Use phospho-specific antibodies to assess autophosphorylation status

  • Compare wild-type and mutant proteins under identical conditions

• Subcellular localization:

  • Use immunofluorescence with confocal microscopy to visualize protein distribution

  • Perform subcellular fractionation followed by Western blotting

  • For nuclear isoforms, specifically assess nuclear targeting efficiency

• Structure-function analysis:

  • Generate constructs with specific mutations (like p.Arg292Pro)

  • Create chimeric proteins or deletion constructs to identify critical domains

  • Express these in neuronal cultures to assess phenotypic effects

• Rescue experiments:

  • Test if wild-type CAMK2G can rescue phenotypes in knockdown models

  • Compare rescue efficiency between wild-type and mutant versions

  • Test domain-specific constructs (e.g., catalytically inactive versions)

The p.Arg292Pro mutation has been shown to act as a pathogenic gain-of-function mutation, leading to increased phosphotransferase activity and impaired neuronal maturation, as well as impaired targeting of nuclear CAMK2G isoforms .

What are common sources of variation in CAMK2G antibody performance across different experimental systems?

Several factors can influence CAMK2G antibody performance:

• Expression level variations:

  • CAMK2G expression varies significantly across brain regions: high in cortex, forebrain, and hippocampus; lower in brainstem and cerebellum

  • Expression patterns differ between developmental stages

  • Expression may be altered in disease states

• Sample preparation issues:

  • Protein degradation due to poor sample handling

  • Incomplete protein extraction from membrane fractions

  • Fixation artifacts in immunohistochemistry

• Antibody-specific considerations:

  • Batch-to-batch variation in polyclonal antibodies

  • Epitope masking due to protein-protein interactions

  • Post-translational modifications affecting epitope recognition

  • Cross-reactivity with other CAMK2 family members (CAMK2A/B/D) due to sequence homology

• Protocol optimization needs:

  • Antigen retrieval methods significantly impact immunohistochemistry results

  • Buffer composition affects antibody binding efficiency

  • Blocking reagents may influence background and specific signal ratio

How can I distinguish between CAMK2G and other CAMK2 family members (CAMK2A, CAMK2B, CAMK2D) in my experiments?

Distinguishing between CAMK2 isoforms requires careful experimental design:

• Antibody selection strategy:

  • Choose antibodies raised against divergent regions of CAMK2G

  • Verify specificity using knockout/knockdown controls for each family member

  • Test multiple antibodies targeting different epitopes

• Experimental approaches:

  • Use higher resolution SDS-PAGE systems to separate isoforms by molecular weight

  • Implement 2D electrophoresis to separate based on both pI and molecular weight

  • Perform isoform-specific immunoprecipitation followed by mass spectrometry

  • Analyze expression patterns in tissues with known differential expression of CAMK2 isoforms

• Controls to implement:

  • Compare antibody reactivity in samples from knockout models of each isoform

  • Analyze reactivity in tissues known to express primarily one isoform

  • Use recombinant proteins of each isoform as standards

What factors should I consider when selecting a CAMK2G antibody for co-immunoprecipitation experiments?

For successful co-immunoprecipitation (co-IP) of CAMK2G:

• Antibody properties:

  • Select antibodies validated specifically for IP applications

  • Consider antibody affinity and specificity (higher affinity is generally preferred)

  • Determine if the epitope is accessible in native conditions

  • Check if the antibody might disrupt protein-protein interactions of interest

• Experimental considerations:

  • Recommended antibody amounts: 0.5-4.0 μg per 1-3 mg of total protein lysate

  • Lysis buffer composition is critical: avoid harsh detergents that might disrupt interactions

  • Cross-linking may be necessary for transient interactions

  • Pre-clearing lysates can reduce non-specific binding

• Controls to include:

  • IgG control of the same species as the primary antibody

  • Input sample (pre-IP lysate)

  • Reverse co-IP when possible

  • Validation with known interaction partners

• Detection strategy:

  • Consider whether to blot for CAMK2G or potential interacting partners

  • Validate novel interactions with multiple techniques (e.g., proximity ligation assay)

  • Mass spectrometry can identify novel binding partners

What is known about the role of CAMK2G in intellectual disability, and how can antibody-based methods help investigate this connection?

Research has revealed important insights into CAMK2G's role in intellectual disability:

• Current understanding:

  • The CAMK2G p.Arg292Pro mutation has been identified in individuals with intellectual disability

  • This mutation acts as a gain-of-function mutation leading to increased phosphotransferase activity

  • CAMK2G is critical for appropriate neuronal maturation and migration

  • Knockdown of CAMK2G results in inappropriate precocious neuronal maturation

• Antibody-based investigation methods:

  • Immunohistochemistry to analyze CAMK2G expression patterns in patient-derived samples

  • Phospho-specific antibodies to assess kinase activity in disease models

  • Antibodies for detection of interaction partners that may be disrupted by pathogenic mutations

  • Antibody-based functional imaging of CAMK2G activity in neuronal cultures

• Research approaches:

  • In vitro neuronal culture systems with CAMK2G mutants

  • In vivo animal models with genetic modifications mirroring human mutations

  • Patient-derived induced pluripotent stem cells differentiated into neurons

How can multi-parameter imaging approaches be optimized when using CAMK2G antibodies alongside other neural markers?

For advanced multi-parameter imaging with CAMK2G antibodies:

• Antibody panel design:

  • Pair CAMK2G antibodies with established neuronal markers such as MAP2 (dendrites), synaptic markers (e.g., synaptic system antibodies), and CAMK2A/B for comparative analysis

  • Select primary antibodies from different host species to avoid cross-reactivity

  • Consider the subcellular localization of each target for optimal spatial resolution

• Sample preparation optimization:

  • Test fixation protocols that preserve all antigens of interest

  • Optimize permeabilization conditions for balanced access to membrane, cytosolic, and nuclear targets

  • Determine if sequential immunostaining is needed for particularly sensitive epitopes

• Imaging considerations:

  • Implement spectral unmixing for closely overlapping fluorophores

  • Use appropriate controls for autofluorescence and channel bleed-through

  • Consider super-resolution techniques for detailed subcellular localization studies

  • For temporal studies, evaluate fixation-resistant fluorescent proteins with antibody detection

• Analysis approaches:

  • Quantify co-localization using appropriate statistical methods

  • Implement automated image analysis pipelines for high-throughput screening

  • Consider 3D reconstruction for complex morphological analysis

What are the latest methodological advances in studying CAMK2G phosphorylation states and their functional significance?

Recent advances in studying CAMK2G phosphorylation include:

• Advanced detection methods:

  • Phospho-specific antibodies targeting key regulatory sites

  • FRET-based sensors to monitor CAMK2G activation in real-time

  • Mass spectrometry approaches for comprehensive phosphosite mapping

  • Proximity ligation assays to detect specific phosphorylated forms in situ

• Functional analysis approaches:

  • Phosphomimetic and phospho-dead mutants to assess functional significance

  • Optogenetic control of CAMK2G activation to determine temporal requirements

  • Single-molecule tracking to monitor phosphorylation-dependent localization changes

  • Cryo-EM studies of CAMK2G conformational changes upon phosphorylation

• Disease-relevant applications:

  • Comparison of phosphorylation patterns between wild-type and p.Arg292Pro mutant CAMK2G

  • Assessment of how pathogenic mutations affect autophosphorylation and substrate targeting

  • Investigation of phosphorylation-dependent protein-protein interactions