CASQ2 Antibody

What is CASQ2 and why is it important in cardiac research?

CASQ2 (Calsequestrin 2) is a calcium-binding protein localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. It functions as the primary calcium storage protein within the sarcoplasmic reticulum, binding 40-50 moles of calcium per molecule. CASQ2 is critical for proper calcium handling during excitation-contraction coupling in cardiomyocytes. The importance of CASQ2 in cardiac research stems from its association with catecholaminergic polymorphic ventricular tachycardia (CPVT), a potentially lethal arrhythmogenic disorder. CASQ2 mutations can alter calcium homeostasis, leading to arrhythmias particularly during adrenergic stimulation .

What types of CASQ2 antibodies are available for research?

There are multiple types of CASQ2 antibodies available, including:

• By host species: Mouse monoclonal and rabbit polyclonal antibodies are most common

• By clonality:

  • Monoclonal: Offer high specificity with defined epitopes (e.g., clone PAT4E10AT, clone EML229, clone E-12)

  • Polyclonal: Provide broader epitope recognition

• By recognized regions:

  • N-terminal region antibodies

  • Full-length protein antibodies

  • Domain-specific antibodies (e.g., AA 20-399, AA 219-300, AA 79-107)

• By conjugation:

  • Unconjugated primary antibodies

  • HRP-conjugated

  • Fluorophore-conjugated (FITC, PE, Alexa Fluor dyes)

  • Agarose-conjugated for immunoprecipitation

Over 200 CASQ2 antibody products are available across at least 21 suppliers .

What are the main applications for CASQ2 antibodies in cardiac research?

CASQ2 antibodies are primarily used in the following applications:

CASQ2 antibodies have been extensively used to characterize CASQ2 expression in genetic models, study protein-protein interactions in the calcium release complex, and validate gene therapy approaches for CPVT2 .

How should I optimize Western blot protocols for CASQ2 detection?

For optimal CASQ2 detection by Western blot:

• Sample preparation:

  • For cardiac tissue: Homogenize in RIPA buffer with protease inhibitors

  • Expected molecular weight: 46.4 kDa theoretical, but typically observed at ~50 kDa due to post-translational modifications

• Recommended protocol adjustments:

  • Protein loading: 20-50 μg of total protein per lane

  • Gel percentage: 10-12% SDS-PAGE gels work optimally

  • Transfer conditions: Semi-dry or wet transfer (90 minutes at 100V) to PVDF membranes

  • Blocking: 5% non-fat milk in TBST for 1 hour at room temperature

  • Primary antibody incubation: 1:1000-1:2000 dilution overnight at 4°C

  • Detection: Compatible with both chemiluminescence and infrared imaging systems

• Controls:

  • Positive control: Heart tissue lysate (human, mouse, or rat)

  • Negative control: CASQ2 knockout tissue or siRNA-treated samples

  • Loading control: GAPDH or pan-cadherin antibodies work well

What are the best approaches for immunohistochemical detection of CASQ2 in cardiac tissues?

For optimal immunohistochemical detection of CASQ2:

• Tissue preparation:

  • Fixation: 4% paraformaldehyde is preferred over formalin for antigen preservation

  • Section thickness: 5-7 μm sections provide optimal results

• Antigen retrieval:

  • Heat-induced epitope retrieval using TE buffer (pH 9.0) works best

  • Alternative: Citrate buffer (pH 6.0) can be used but may yield lower signal

• Protocol recommendations:

  • Blocking: 10% normal serum from secondary antibody host species + 0.1% Triton X-100

  • Primary antibody dilution: 1:50-1:100 for most commercial antibodies

  • Incubation time: Overnight at 4°C yields optimal results

  • Detection: Both HRP-DAB and fluorescent detection systems are compatible

  • Counterstaining: Hematoxylin for brightfield or DAPI for fluorescence

• Expected pattern:

  • CASQ2 shows a striated pattern in cardiomyocytes

  • Co-staining with Contactin2 (Cntn2) can help identify specialized conduction cells

How do I differentiate between skeletal muscle CASQ1 and cardiac CASQ2 in research applications?

Differentiating between CASQ1 (skeletal) and CASQ2 (cardiac) requires careful experimental design:

• Antibody selection:

  • Choose antibodies raised against non-conserved regions between CASQ1 and CASQ2

  • Validate antibody specificity using tissues from CASQ2-null mice as negative controls

• Expression analysis techniques:

  • RT-PCR: Use isoform-specific primers targeting unique regions

  • For CASQ2: Primers targeting exons 4-8 (e.g., GCTGGAGGTCCAGGCCTTTGAG and GGCCACGATGTGGATCCCATTC)

  • For CASQ1: Specific primers such as GATGCAGCTGTGGCCAAGAAAC and CATAGGCTCTTCCATGAAGGCC

  • Normalize against housekeeping genes like β-microtubulin

• Protein analysis:

  • Western blot: CASQ1 (~55 kDa) can be distinguished from CASQ2 (~50 kDa) by molecular weight

  • Immunostaining: CASQ1 is predominantly expressed in fast-twitch skeletal muscle, while CASQ2 is found in cardiac and slow-twitch skeletal muscle

• Tissue specificity:

  • Cardiac tissue expresses predominantly CASQ2

  • Skeletal muscle expresses both CASQ1 and CASQ2, with type-specific distribution

How can CASQ2 antibodies be used to study CPVT disease mechanisms?

CASQ2 antibodies have been instrumental in elucidating CPVT disease mechanisms:

• Mutation characterization studies:

  • Western blot analysis using CASQ2 antibodies reveals protein expression levels in different CASQ2 mutations

  • Some mutations (e.g., G112+5X) result in complete absence of detectable protein

  • Others (e.g., D307H) show significantly reduced protein levels despite normal mRNA levels

• Protein-protein interaction studies:

  • Co-immunoprecipitation with CASQ2 antibodies can identify interactions with the calcium release complex (RyR2, triadin, junctin)

  • Changes in these interactions are often observed in CPVT models

• Compensatory mechanism investigation:

  • CASQ2 antibodies reveal upregulation of other calcium-handling proteins like calreticulin (CRT) in CASQ2-deficient models

  • Immunoblotting of CASQ2 knockout models shows near absence of triadin-1 and junctin

• Arrhythmia mechanism studies:

  • Immunofluorescence combined with calcium imaging reveals the relationship between CASQ2 distribution and abnormal calcium handling

  • CASQ2 antibodies help correlate structural changes in the sarcoplasmic reticulum with functional defects

What are the considerations when using CASQ2 antibodies to validate gene therapy approaches?

When using CASQ2 antibodies to validate gene therapy approaches:

• Expression verification:

  • Western blotting to confirm successful expression of the delivered CASQ2 gene

  • Quantification relative to endogenous levels in control samples

  • Detection of transgene-specific tags (e.g., RFP via T2A peptide cleavage)

• Localization confirmation:

  • Immunofluorescence to verify proper targeting to the sarcoplasmic reticulum

  • Co-localization with SR markers (e.g., RyR2) to confirm appropriate subcellular distribution

  • Comparison with wild-type distribution patterns

• Technical considerations:

  • When using viral vectors (e.g., AAV9-CASQ2-RFP), confirm antibody doesn't cross-react with viral components

  • For constructs with self-cleaving peptides (T2A), verify complete processing using anti-T2A antibodies

  • Include controls for antibody specificity using non-transduced tissues

• Functional correlation:

  • Combine antibody-based detection with functional readouts (calcium imaging, electrophysiology)

  • Quantitative correlation between CASQ2 expression levels and functional rescue

How can CASQ2 antibodies be applied in iPSC-derived cardiomyocyte disease models?

CASQ2 antibodies play key roles in iPSC-derived cardiomyocyte disease models:

• Model validation:

  • Western blot to confirm CASQ2 deficiency in patient-derived iPSC-CMs

  • Immunofluorescence to verify absence or mislocalization of CASQ2 in disease models

• Differentiation assessment:

  • Flow cytometry using CASQ2 and α-sarcomeric actinin antibodies to quantify cardiomyocyte purity

  • Immunostaining to assess maturation state of iPSC-derived cardiomyocytes

• Therapeutic intervention evaluation:

  • Western blotting to quantify CASQ2 restoration after gene therapy

  • Immunofluorescence to confirm proper localization of restored CASQ2

  • Correlating protein expression with functional phenotype reversal

• Experimental protocol recommendations:

  • For flow cytometry: Fix cells in 1% paraformaldehyde, permeabilize, and stain with anti-CASQ2 and lineage markers

  • For immunofluorescence: Co-stain with α-actinin to identify sarcomeric structures

  • For western blot: Load at least 20 μg of total protein from differentiated iPSC-CMs

What are common challenges in detecting CASQ2 by Western blot and how can they be addressed?

Common Western blot challenges and solutions:

• Low signal intensity:

  • Increase protein loading (50-100 μg)

  • Extend primary antibody incubation (overnight at 4°C)

  • Use more sensitive detection methods (enhanced chemiluminescence)

  • Reduce washing stringency by decreasing detergent concentration

• Multiple bands or non-specific signals:

  • Increase blocking time and concentration (5% milk or BSA for 2 hours)

  • Optimize primary antibody dilution (test range from 1:500-1:5000)

  • Use monoclonal antibodies for higher specificity

  • Include CASQ2 knockout control to identify specific bands

• Inconsistent results between antibody lots:

  • Validate new lots against previous ones before full experimental use

  • Consider using pooled antibody preparations for long-term projects

  • Include standard positive control samples in each experiment

• Degradation products:

  • Use fresh tissue samples and maintain cold chain

  • Include protease inhibitors in lysis buffer

  • Avoid repeated freeze-thaw cycles of protein samples

How should I optimize immunofluorescence protocols for detecting CASQ2 in different experimental systems?

Optimization strategies for CASQ2 immunofluorescence:

• Cell culture systems:

  • Fixation: 4% paraformaldehyde for 10-15 minutes at room temperature

  • Permeabilization: 0.1% Triton X-100 for 10 minutes

  • Blocking: 10% serum (from secondary antibody species) for 1 hour

  • Antibody dilution: Start with 1:100 and adjust as needed

• Tissue sections:

  • Section thickness: 5-7 μm provides optimal resolution

  • Antigen retrieval: Heat-mediated in TE buffer (pH 9.0)

  • Background reduction: Include 0.1-0.3% Triton X-100 in antibody diluent

  • Signal enhancement: Tyramide signal amplification for low abundance detection

• iPSC-derived cardiomyocytes:

  • Fixation timing: Fix cells after beating has started (typically day 10-14)

  • Co-staining: Include α-actinin to identify cardiomyocytes

  • Nuclear counterstain: DAPI at 1:1000 dilution

  • Mounting: Use anti-fade mounting medium to preserve fluorescence

• Imaging parameters:

  • Confocal microscopy: Use Z-stacking (0.5 μm steps) to capture full CASQ2 distribution

  • Exposure settings: Determine optimal settings using wild-type controls

  • Resolution: 63x oil immersion objectives provide optimal subcellular detail

What controls are essential when using CASQ2 antibodies in knockout or mutation studies?

Essential controls for CASQ2 antibody use in genetic models:

• Genotype controls:

  • Wild-type tissue/cells as positive controls

  • Complete CASQ2 knockout samples as negative controls

  • Heterozygous samples to establish detection sensitivity

  • Isotype-matched irrelevant antibodies to assess non-specific binding

• RNA-protein correlation controls:

  • RT-PCR or qPCR analysis to correlate mRNA expression with protein levels

  • RNAscope or in situ hybridization to compare transcript and protein localization

• Cross-reactivity controls:

  • Other calsequestrin family members (CASQ1) to assess isoform specificity

  • Species specificity: Test antibody against CASQ2 from different species if working with non-human models

• Technical validation controls:

  • Secondary antibody-only controls to assess background

  • Multiple antibodies targeting different CASQ2 epitopes to confirm results

  • Peptide blocking experiments to confirm specificity

How can CASQ2 antibodies be utilized in studying ubiquitin-mediated degradation pathways?

CASQ2 antibodies can be valuable tools for studying protein degradation mechanisms:

• Ubiquitination analysis protocol:

  • Immunoprecipitate CASQ2 using specific antibodies

  • Probe with anti-ubiquitin antibodies to detect ubiquitinated CASQ2

  • Alternative approach: Use ubiquitin enrichment kits followed by CASQ2 antibody detection

  • Include proteasome inhibitors (MG132) to accumulate ubiquitinated species

• Degradation pathway investigation:

  • Compare CASQ2 levels in samples treated with various pathway inhibitors:

    • Proteasome inhibitors (MG132, bortezomib)

    • Lysosomal inhibitors (chloroquine, bafilomycin A1)

    • Autophagy inhibitors (3-methyladenine)

  • Monitor CASQ2 half-life using cycloheximide chase assays and antibody detection

• Mutation impact assessment:

  • Compare ubiquitination patterns between wild-type and mutant CASQ2

  • The D307H mutation has been studied for potential enhanced degradation

  • Correlate protein stability with functional parameters using both biochemical and functional assays

What are the best approaches for multiplexed detection of CASQ2 and interacting proteins?

For multiplexed detection of CASQ2 and its interaction partners:

• Co-immunofluorescence optimization:

  • Antibody selection: Choose primary antibodies from different host species

  • For example: Mouse anti-CASQ2 with rabbit anti-RyR2, rabbit anti-CASQ2 with mouse anti-Triadin

  • Use highly cross-adsorbed secondary antibodies to prevent cross-reactivity

  • Sequential staining protocol when using multiple antibodies from the same species

• Proximity ligation assay (PLA):

  • Combines antibody specificity with rolling circle amplification

  • Can detect protein interactions within 40 nm distance

  • Optimal for studying CASQ2 interactions with RyR2, triadin, and junctin

  • Controls: Omit one primary antibody; use non-interacting protein pairs

• Advanced imaging approaches:

  • Super-resolution microscopy (STORM, PALM) for nanoscale spatial organization

  • Expansion microscopy to physically expand samples for enhanced resolution

  • Live-cell imaging using antibody fragments or nanobodies

• Biochemical multiplexing:

  • Sequential immunoblotting with antibody stripping between detections

  • Multiplex Western blot using differentially labeled secondary antibodies

  • Co-immunoprecipitation followed by mass spectrometry for unbiased interaction studies

How can CASQ2 antibodies be used in high-throughput screening of potential therapeutics for CPVT?

CASQ2 antibodies can facilitate high-throughput screening for CPVT therapeutics:

• Cell-based screening platforms:

  • Develop immunofluorescence-based assays in 96/384-well formats

  • Primary readouts can include:

    • CASQ2 protein levels/stability for nonsense mutation therapies

    • CASQ2 localization for trafficking defect corrections

    • CASQ2-RyR2 interaction for functional modulator screening

• Automated screening workflow:

  • Sample preparation: Fixed iPSC-derived cardiomyocytes or cell lines

  • Primary antibody: Anti-CASQ2 (1:200 dilution)

  • Secondary detection: Fluorophore-conjugated or HRP-coupled antibodies

  • Image acquisition: Automated microscopy or high-content imaging systems

  • Analysis: Machine learning algorithms for phenotypic classification

• Validation methods for hits:

  • Dose-response curves using CASQ2 antibodies in Western blot

  • Functional confirmation using calcium imaging or electrophysiology

  • Target engagement verification using cellular thermal shift assays with CASQ2 antibodies

• Translational assessment:

  • Validate hits in patient-derived iPSC-CMs using CASQ2 antibodies

  • Combine with functional readouts to correlate protein correction with arrhythmia suppression

What are the validated epitopes for commonly used CASQ2 antibodies?

Validated epitopes for commercial CASQ2 antibodies:

Most commercially available antibodies recognize epitopes contained within the mature protein (residues 20-399) after signal peptide cleavage. Monoclonal antibodies often target specific domains, while polyclonal preparations typically recognize multiple epitopes .

What are the recommended storage and handling conditions for CASQ2 antibodies?

Optimal storage and handling of CASQ2 antibodies:

• Storage conditions:

  • Short-term (up to 1 month): 4°C

  • Long-term: -20°C in small aliquots

  • Avoid repeated freeze-thaw cycles (limit to <5)

  • Some formulations contain 50% glycerol for freeze-thaw stability

• Buffer composition effects:

  • Most commercial antibodies are supplied in PBS with 0.02% sodium azide

  • Some include 50% glycerol at pH 7.3 for stability

  • BSA (0.1%) may be included in smaller volume preparations

• Shelf-life considerations:

  • Typical shelf life: 12 months at -20°C

  • 1 month at 4°C without significant loss of activity

  • Activity can be maintained longer with proper aliquoting

• Working solution preparation:

  • Briefly centrifuge vial before opening

  • Dilute only the amount needed for immediate use

  • Prepare working solutions in fresh buffer containing 1% BSA

  • For repeated use of diluted antibody, add preservative (0.01% sodium azide)