ccdc65 Antibody

What is CCDC65 and why is it significant in research?

CCDC65 (also known as CFAP250, DRC2, FAP250, and NYD-SP28) is a protein located on the long arm of chromosome 12. It functions as an essential component of the nexin-dynein regulatory complex participating in the formation of motile cilia . CCDC65 has gained significant research interest due to its dual role in ciliary function and tumor suppression. Mutations in CCDC65 cause primary ciliary dyskinesia (PCD), a disease characterized by impaired ciliary function leading to chronic sinopulmonary disease . Additionally, CCDC65 has been identified as a potential tumor suppressor in multiple cancer types, including gastric cancer and lung adenocarcinoma .

What cellular localization pattern should I expect when using a CCDC65 antibody?

When properly used, CCDC65 antibodies should primarily localize to the cilia of normal epithelial cells. In immunofluorescence studies of nasal epithelial cells, CCDC65 is localized specifically to the cilia, as demonstrated using rabbit anti-CCDC65 antibodies (1:100 dilution, Novus Biologicals) . This ciliary localization pattern is consistent with CCDC65's function as a component of the nexin-dynein regulatory complex. In cells with CCDC65 mutations or in which CCDC65 has been silenced, the antibody staining will be absent from the cilia, which can serve as an important negative control for antibody specificity .

How is CCDC65 expression regulated during ciliogenesis?

CCDC65 expression is upregulated during ciliogenesis, coinciding with the expression of FOXJ1, a master regulator of ciliogenesis. In primary cultures of human tracheal epithelial cells (hTEC), CCDC65 is initially detected during early ciliated cell differentiation (around Day 7 post air-liquid interface), alongside FOXJ1 expression . This timing suggests CCDC65 is associated with ciliogenesis. Furthermore, in Chlamydomonas reinhardtii, expression of DRC2 (the CCDC65 orthologue) increases significantly following deflagellation, with expression elevated to 6.7-fold at 3 minutes, 13.6-fold at 10 minutes, and 7.8-fold at 30 minutes before returning to near baseline levels at 60 minutes .

What is the molecular mechanism by which CCDC65 functions as a tumor suppressor?

CCDC65 functions as a tumor suppressor through at least two distinct molecular mechanisms:

• c-Myc Pathway: CCDC65 recruits E3 ubiquitin ligase FBXW7 to induce the ubiquitination degradation of c-Myc, a known oncogenic transcription factor. This reduces c-Myc binding to the ENO1 promoter, suppressing ENO1 transcription .

• ENO1/AKT1 Pathway: CCDC65 binds to ENO1 through its domain (amino acids 130-484) and promotes ENO1's ubiquitylation and degradation by recruiting FBXW7. The downregulation of ENO1 reduces its binding to AKT1, leading to inactivation of AKT1 and subsequent inhibition of cell proliferation and EMT signals .

These mechanisms highlight CCDC65's role in regulating protein degradation pathways that control cell cycle progression and cellular transformation.

How do I interpret conflicting CCDC65 antibody staining patterns in different cancer types?

Variations in CCDC65 antibody staining patterns across cancer types likely reflect tissue-specific regulation and function of CCDC65. When interpreting seemingly conflicting results:

• Consider expression levels by cancer type: CCDC65 is downregulated in multiple cancer types, including gastric cancer and lung adenocarcinoma, but the degree of downregulation may vary .

• Examine subcellular localization: In normal cells, CCDC65 localizes to cilia, but cancer cells often show reduced or altered ciliary structures, potentially affecting localization patterns.

• Validate with multiple techniques: Complement immunohistochemistry with western blotting and qRT-PCR to confirm expression patterns, as was done in studies of gastric cancer tissues where all three methods showed consistent downregulation .

• Consider genetic alterations: Mutations or epigenetic changes affecting CCDC65 might be cancer-type specific, resulting in different antibody recognition patterns.

What is the relationship between CCDC65's role in ciliary function and its tumor suppressor activity?

The dual role of CCDC65 in ciliary function and tumor suppression represents an intriguing connection that is still being elucidated. Current research suggests:

• Ciliary dysregulation in cancer: Primary cilia act as cellular antennae that regulate key signaling pathways including Hedgehog, Wnt, and PDGF. Loss of CCDC65 may disrupt these pathways, contributing to tumorigenesis independent of its direct tumor suppressor functions .

• Shared molecular partners: CCDC65 interacts with proteins like Gas8 in its ciliary function , and with FBXW7 in its tumor suppressor role . These interactions may represent nodes where ciliary and tumor suppressor functions intersect.

• Cell cycle regulation: Ciliary integrity is linked to cell cycle regulation, and CCDC65's role in both processes suggests it may serve as a molecular bridge between ciliary function and cell proliferation control.

What are the optimal conditions for CCDC65 antibody use in immunofluorescence studies?

Based on published research protocols, optimal conditions for CCDC65 antibody use in immunofluorescence include:

• Antibody selection: Rabbit anti-CCDC65 antibody (Novus Biologicals) has been successfully used at 1:100 dilution .

• Fixation method: Paraformaldehyde fixation (4%) preserves CCDC65 epitopes while maintaining cellular structure.

• Co-staining markers: Use acetylated α-tubulin (1:5000, clone 6-11-B1, Sigma Aldrich) as a ciliary marker to confirm localization .

• Detection system: Secondary antibodies conjugated to Alexa Fluor dyes (Life Technologies) provide good signal-to-noise ratio .

• Controls: Include samples from CCDC65-deficient cells or tissues as negative controls to confirm antibody specificity.

• Imaging: Epifluorescent microscopy with appropriate band-pass filter cubes optimized for the secondary antibody fluorophores allows clear visualization of CCDC65 localization .

How can I validate CCDC65 knockdown/knockout efficiency in experimental models?

Validation of CCDC65 knockdown or knockout requires a multi-faceted approach:

• mRNA expression analysis:

  • Use RT-PCR with validated primers such as:

    • 5′-TCCTGTTCGAGGGCTGAGAT-3′ (forward)

    • 5′-GGGGATTGGATCCGGGAAAG-3′ (reverse)

  • Normalize to stable reference genes like OAZ1

• Protein expression analysis:

  • Western blotting using anti-CCDC65 antibodies (1:100 dilution)

  • Use β-actin or GAPDH as loading controls

• Immunofluorescence microscopy:

  • Confirm loss of ciliary localization in knockdown cells

  • Co-stain with ciliary markers to ensure ciliary structures remain intact

• Functional validation:

  • For ciliary function: Assess ciliary beat patterns using high-speed video microscopy

  • For tumor suppressor function: Measure cell proliferation and EMT markers

What is the protocol for performing CCDC65-related ubiquitination assays?

The ubiquitination assay for CCDC65-mediated protein degradation follows these steps:

• Cell preparation:

  • Transfect cells with vectors expressing CCDC65 (or control)

  • Co-transfect with vectors expressing target proteins (e.g., c-Myc or ENO1) and ubiquitin

• Proteasome inhibition:

  • Treat cells with MG132 (20 μM) for 4 hours before harvesting proteins to prevent degradation of ubiquitinated proteins

• Protein extraction:

  • Extract proteins using IP lysis buffer with protease inhibitors

• Immunoprecipitation:

  • Perform immunoprecipitation with antibodies against target proteins (e.g., anti-c-Myc or anti-ENO1)

  • Use appropriate controls (normal IgG, input samples)

• Western blotting:

  • Resolve samples by SDS-PAGE

  • Transfer to PVDF membranes

  • Probe with anti-ubiquitin antibodies to detect ubiquitination

  • Strip and reprobe with antibodies against target proteins to confirm their identity

• Data analysis:

  • Compare ubiquitination patterns between samples with and without CCDC65 expression

  • Quantify band intensities using appropriate software

What cell models are most appropriate for studying CCDC65 function?

The selection of cell models for CCDC65 research depends on the specific aspect being studied:

• For ciliary function studies:

  • Primary human tracheal epithelial cells (hTEC) cultured at air-liquid interface to promote ciliogenesis

  • Nasal epithelial cells obtained from nasal brushings

  • Immortalized respiratory epithelial cell lines that retain ciliary function

• For tumor suppressor studies:

  • Gastric cancer cell lines (e.g., BGC-823, MGC-803) for gastric cancer studies

  • Lung adenocarcinoma cell lines (e.g., A549, H1299) for lung cancer studies

  • Patient-derived primary cancer cells for increased clinical relevance

• For mechanistic studies:

  • HEK293T cells for protein interaction and ubiquitination studies

  • Chlamydomonas reinhardtii for evolutionary conserved functions of CCDC65/DRC2

Each model offers distinct advantages, and combining multiple models provides more robust evidence for CCDC65 function.

How can I effectively silence CCDC65 expression for functional studies?

Effective CCDC65 silencing can be achieved through several approaches:

• shRNA-mediated knockdown:

  • Use validated shRNA sequences targeting CCDC65:

    • CCAAGGAGTTTGAGACAGAAA (shRNA#1)

    • CCAAACATTTGAACGAGTGGT (shRNA#2)

    • GCAAGATATCTTCATGGCCAT (shRNA#3)

    • GCTGCTTCTGTTTCAGCAGAA (shRNA#4)

  • Deliver via lentiviral transduction for efficient and stable knockdown

  • Select transduced cells using puromycin (2.5 μg/ml) for 5 days

• CRISPR/Cas9-mediated knockout:

  • Design guide RNAs targeting early exons of CCDC65

  • Verify genomic modifications by sequencing

  • Isolate and characterize single-cell clones

• Validation controls:

  • Include non-targeted sequence controls

  • Monitor knockdown efficiency by qRT-PCR and western blotting

  • Assess functional consequences using appropriate assays

What experimental approaches can determine if metformin-induced CCDC65 expression could be therapeutically relevant?

To evaluate the therapeutic potential of metformin-induced CCDC65 expression, consider these experimental approaches:

• Dose-response and time-course studies:

  • Treat cancer cell lines with varying concentrations of metformin

  • Monitor CCDC65 expression at multiple time points by qRT-PCR and western blotting

  • Correlate CCDC65 induction with anti-tumor effects

• Mechanism of induction:

  • Use reporter assays with the CCDC65 promoter to determine if metformin directly affects transcription

  • Examine the role of AMPK activation in CCDC65 induction

  • Investigate epigenetic modifications of the CCDC65 promoter following metformin treatment

• Combinatorial approaches:

  • Test metformin in combination with other cancer therapeutics

  • Evaluate synergistic effects on CCDC65 expression and tumor suppression

  • Determine if CCDC65 expression predicts response to combination therapy

• In vivo validation:

  • Use xenograft models with and without CCDC65 knockdown

  • Administer metformin and monitor tumor growth

  • Analyze tumor samples for CCDC65 expression, ENO1 levels, and AKT1 activation

• Clinical correlation:

  • Analyze CCDC65 expression in tumor samples from cancer patients on metformin

  • Correlate expression with clinical outcomes

  • Consider CCDC65 as a potential biomarker for metformin response

What are common pitfalls when working with CCDC65 antibodies and how can they be addressed?

Researchers working with CCDC65 antibodies may encounter several challenges:

• Specificity issues:

  • Validate antibody specificity using CCDC65 knockout/knockdown samples

  • Perform peptide competition assays to confirm epitope specificity

  • Test multiple antibodies targeting different epitopes

• Low signal intensity:

  • CCDC65 is normally expressed at moderate levels; optimize antibody concentration

  • Consider signal amplification methods like tyramide signal amplification

  • Extend primary antibody incubation time (overnight at 4°C)

• Cross-reactivity:

  • Pre-absorb antibodies with relevant tissues/cell lysates

  • Use highly purified recombinant CCDC65 as a positive control

  • Include appropriate negative controls (isotype controls, secondary-only controls)

• Sample preparation artifacts:

  • Optimize fixation protocols; overfixation may mask epitopes

  • Consider antigen retrieval methods for formalin-fixed samples

  • Use fresh samples when possible, especially for ciliary localization studies

• Quantification challenges:

  • Use digital image analysis software with consistent parameters

  • Include internal reference standards in each experiment

  • Blind the analysis to experimental conditions

How can I correlate CCDC65 expression with functional outcomes in my research?

To effectively correlate CCDC65 expression with functional outcomes:

• Establish clear expression baselines:

  • Quantify CCDC65 expression across multiple cancer and normal cell lines

  • Create standard curves for absolute quantification

  • Determine tissue-specific expression patterns

• Utilize multiparametric analysis:

  • Correlate CCDC65 expression with:

    • Proliferation markers (Ki-67, PCNA)

    • Cell cycle distribution (flow cytometry)

    • Apoptosis markers (cleaved caspase-3, PARP)

    • EMT markers (E-cadherin, vimentin)

• Implement rescue experiments:

  • Reintroduce wild-type CCDC65 in deficient cells

  • Test domain-specific constructs (e.g., a.a. 130-484)

  • Create and test point mutations to identify critical residues

• Examine pathway activation:

  • Monitor AKT1 phosphorylation status

  • Assess c-Myc and ENO1 levels

  • Evaluate downstream targets of affected pathways

• Clinical correlation:

  • Compare CCDC65 levels in patient samples with:

    • Clinical stage

    • Lymph node metastasis

    • Distant metastasis

    • Patient survival

What are promising avenues for further investigation of CCDC65 in cancer research?

Several promising research directions for CCDC65 in cancer include:

• Comprehensive cancer type profiling:

  • Expand studies beyond gastric and lung cancers to other cancer types

  • Develop a CCDC65 expression atlas across cancer types and subtypes

  • Correlate expression patterns with genomic alterations

• Structural biology approaches:

  • Determine the crystal structure of CCDC65, particularly the 130-484 a.a. domain

  • Identify critical interaction interfaces with ENO1, FBXW7, and other partners

  • Design peptide mimetics to modulate CCDC65 functions

• Therapeutic targeting strategies:

  • Develop small molecules that enhance CCDC65 expression or stability

  • Expand studies on metformin and identify other compounds that induce CCDC65

  • Create therapeutic antibodies that mimic CCDC65 tumor suppressor functions

• Dual-function exploration:

  • Investigate the mechanistic links between CCDC65's ciliary and tumor suppressor roles

  • Determine if ciliary dysfunction contributes to cancer progression

  • Explore if cancer therapies affect ciliary function through CCDC65 modulation

• Biomarker development:

  • Validate CCDC65 as a prognostic biomarker in prospective clinical studies

  • Develop diagnostic assays for CCDC65 expression in patient samples

  • Investigate CCDC65 as a predictive biomarker for response to specific therapies