CCZ1B Antibody

What is CCZ1/CCZ1B and what cellular functions does it regulate?

CCZ1 is a guanine nucleotide exchange factor involved in endolysosomal trafficking that plays a crucial role in regulating vesicle trafficking and membrane dynamics within cells . CCZ1 functions in a complex with MON1 (composed of MON1A and MON1B proteins) to control endosomal trafficking pathways . This protein complex is essential for:

• Regulating early to late endosomal trafficking

• Maintaining endolysosomal homeostasis

• Supporting proper vesicular transport mechanisms

• Facilitating membrane remodeling during cellular processes

Recent research has identified CCZ1 as an essential host factor for viral infections, particularly for filoviruses like Marburg and Ebola, as well as SARS-CoV-2, highlighting its importance in endocytosis-dependent processes .

What applications are CCZ1/CCZ1B antibodies validated for?

The CCZ1/CCZ1B polyclonal antibody (such as PACO2711) has been validated for several research applications, including:

• Western blotting (recommended dilution 1:500-1:2000)

• ELISA assays

• Immunostaining of cells and tissues

These applications enable researchers to study CCZ1/CCZ1B expression levels, localization patterns, and interactions with other proteins. The antibody has demonstrated reactivity with human, mouse, and monkey samples, making it versatile for comparative studies across species .

What are the recommended sample preparation methods for optimal results with CCZ1/CCZ1B antibodies?

For optimal results when using CCZ1/CCZ1B antibodies, consider the following sample preparation guidelines:

When preparing samples for Western blot analysis, ensure complete denaturation of proteins using appropriate buffers containing SDS and reducing agents. For immunostaining applications, optimization of fixation methods may be necessary depending on the specific epitope accessibility .

How can I validate CCZ1 knockdown or knockout efficiency in my experimental model?

To validate CCZ1 knockdown or knockout efficiency, implement a multi-level validation approach:

• Protein level validation: Western blot analysis using a validated CCZ1/CCZ1B antibody is the gold standard. Compare band intensity between treated and control samples through densitometry analysis. A successful knockdown typically shows at least 50-70% reduction in protein expression compared to controls .

• mRNA level validation: Perform qRT-PCR using CCZ1-specific primers to quantify transcript levels. This complements protein level analysis and can reveal discrepancies between transcriptional and translational regulation.

• Functional validation: Assess the phenotypic effects of CCZ1 knockdown by examining endolysosomal trafficking. For example, defects in early-to-late endosomal conversion or alterations in Rab7 recruitment can confirm functional impairment .

For CRISPR-Cas9 mediated knockout validation, researchers have successfully used sgRNAs targeting the CCZ1 locus (e.g., GCTGTGTGCTTTATGATCGA), followed by antibiotic selection and clonal isolation .

What controls should I include when studying CCZ1's role in viral infection models?

When investigating CCZ1's role in viral infection models, include these essential controls:

• Positive controls:

  • NPC1 knockout cells (for filovirus studies)

  • RAB7 knockout cells (for endosomal trafficking verification)

• Genetic rescue controls:

  • Reversion of gene-trap (inverted sister clones)

  • Transcomplementation with wild-type CCZ1

• Specificity controls:

  • Infection with viruses that use different entry pathways (e.g., Lassa virus, which enters at late endosome stage and is not affected by CCZ1 knockout)

• Dose response controls:

  • Test multiple MOIs (e.g., MOI 0.1, 1, and 5) to ensure effects are consistent across infection levels

• Time course analysis:

  • Collect data at different time points post-infection to distinguish between effects on entry versus replication

How can I differentiate between CCZ1 and CCZ1B functions using antibody-based approaches?

Differentiating between CCZ1 and CCZ1B functions requires strategic experimental design:

• Isoform-specific antibodies: While some antibodies recognize both proteins (like PACO2711), isoform-specific antibodies can help distinguish their individual functions. When using a dual-specificity antibody, complement with RNA interference approaches targeting each isoform separately .

• Co-immunoprecipitation studies: Use CCZ1/CCZ1B antibodies for co-IP experiments followed by mass spectrometry to identify unique binding partners for each isoform, providing insights into differential functions.

• Subcellular fractionation: Combine with Western blotting to determine if CCZ1 and CCZ1B show distinct subcellular localization patterns, suggesting specialized functions.

• Selective knockdown: Design siRNAs targeting unique regions of CCZ1 versus CCZ1B, then perform rescue experiments with constructs resistant to the siRNA to confirm specificity of observed phenotypes.

• Advanced microscopy: Use super-resolution imaging with fluorescently labeled antibodies to visualize potential differences in the spatial distribution of these proteins within cellular compartments.

How can CCZ1/CCZ1B antibodies be used to study viral pathogenesis mechanisms?

CCZ1/CCZ1B antibodies are valuable tools for investigating viral pathogenesis through multiple approaches:

• Entry pathway characterization: Use immunofluorescence with CCZ1 antibodies to track co-localization of viral particles with endosomal markers during entry. This reveals if viruses hijack CCZ1-dependent trafficking pathways .

• Host-pathogen interaction studies: Employ co-immunoprecipitation with CCZ1 antibodies to identify viral proteins that directly interact with the CCZ1-MON1 complex during infection.

• Infection mechanism analysis in relevant models: Use CCZ1 antibodies in advanced model systems such as:

  • 3D primary human hepatocyte cultures (for hepatotropic viruses)

  • Human blood-vessel organoids (for hemorrhagic viruses like Ebola and Marburg)

• Temporal dynamics of infection: Perform time-course immunostaining to map how CCZ1 localization changes during viral infection progression.

Researchers have demonstrated that CCZ1 knockout nearly completely abolishes Marburg and Ebola infections (>98% reduction) and significantly impairs SARS-CoV-2 infection, while having no effect on Lassa virus, highlighting CCZ1's specific role in endosomal trafficking during viral entry .

How should I interpret contradictory results between in vitro cell line and organoid models when studying CCZ1?

When facing contradictory results between different model systems, consider these analytical approaches:

• Model-specific biology: Cell lines often show more dramatic phenotypes than organoids when manipulating CCZ1. For example, CCZ1 knockout in A549 cells showed >98% reduction in MARV infection, while siRNA knockdown in primary hepatocytes showed a 68-75% reduction . This difference likely reflects:

  • Physiological compensation mechanisms present in primary tissues

  • Different baseline expression levels of CCZ1 and related proteins

  • Complex 3D architecture affecting viral entry dynamics

• Knockdown efficiency variations: Technical differences in knockdown/knockout efficiency contribute to phenotypic variations. In primary hepatocytes, siRNA achieved only 52.6% reduction in CCZ1 protein levels, potentially explaining the less pronounced effect compared to complete knockout .

• Systematic validation across models: To resolve contradictions, perform parallel experiments in:

  • Cell lines (convenient for mechanism studies)

  • Primary cell suspensions (intermediate complexity)

  • 3D organoids (physiologically relevant)

• Context-dependent functions: CCZ1 may have additional roles in specialized tissues. For example, in blood-vessel organoids, CCZ1 knockout showed greater inhibition of MARV infection (99.4-99.8%) than in monolayer cultures (85.2-90.7%), suggesting enhanced dependence on CCZ1 in the organoid context .

What are the emerging research areas that might benefit from CCZ1/CCZ1B antibody applications?

Several cutting-edge research areas could benefit from applications of CCZ1/CCZ1B antibodies:

• Antiviral therapeutic development: Targeting CCZ1-dependent pathways offers potential for broad-spectrum antiviral approaches against filoviruses and potentially SARS-CoV-2. Research can employ CCZ1 antibodies to:

  • Screen for compounds disrupting CCZ1-virus interactions

  • Evaluate off-target effects on normal endolysosomal trafficking

• Neurological disease research: Given the importance of endolysosomal trafficking in neurons, CCZ1 antibodies could help investigate:

  • Neurodegenerative disease mechanisms

  • Neuronal membrane dynamics

  • Synaptic vesicle recycling pathways

• Organoid-based disease modeling: CCZ1 antibodies enable characterization of trafficking defects in patient-derived organoids for:

  • Liver diseases (using hepatocyte spheroids)

  • Vascular disorders (using blood-vessel organoids)

  • Personalized medicine approaches

• Immune cell function: Building on findings related to B cell receptors in autoimmunity, CCZ1 antibodies could help explore:

  • Endosomal trafficking in immune cell activation

  • Antigen presentation pathways

  • Immune dysregulation in autoimmune conditions

Why might I observe non-specific binding when using CCZ1/CCZ1B antibodies?

Non-specific binding with CCZ1/CCZ1B antibodies can result from several factors:

• Cross-reactivity with related proteins: CCZ1 and CCZ1B share significant sequence homology with other trafficking proteins. To mitigate this:

  • Increase antibody dilution (try 1:1000 or higher)

  • Include additional blocking reagents (5% BSA or 5% milk)

  • Perform antibody validation in knockout cell lines as negative controls

• Sample preparation issues:

  • Incomplete denaturation for Western blotting

  • Excessive fixation masking epitopes

  • Insufficient blocking of non-specific binding sites

• Detection system optimization:

  • For fluorescent detection, use appropriate filters to minimize autofluorescence

  • For HRP-based detection, optimize exposure times to reduce background

• Technical considerations:

  • The immunogen used for PACO2711 is derived from the C-terminal region of human CGI-43, which may contribute to specific binding patterns that should be considered when interpreting results

How can I optimize Western blot protocols for detecting low-abundance CCZ1 protein?

For detecting low-abundance CCZ1 protein, optimize your Western blot protocol with these specialized techniques:

• Sample enrichment strategies:

  • Increase total protein loading (50-100 µg)

  • Perform subcellular fractionation to concentrate endosomal compartments

  • Use immunoprecipitation to enrich CCZ1 before Western blotting

• Enhanced detection methods:

  • Utilize high-sensitivity ECL substrates

  • Consider fluorescent secondary antibodies for better quantification

  • Use signal amplification systems for extremely low abundance

• Membrane and transfer optimization:

  • Select appropriate membrane pore size (PVDF for higher binding capacity)

  • Use wet transfer methods at lower voltage for longer duration (overnight at 30V)

  • Add 0.1% SDS to transfer buffer to enhance large protein transfer

• Antibody protocol refinement:

  • Extend primary antibody incubation (overnight at 4°C)

  • Use optimized dilution (start with 1:500 for low abundance)

  • Consider signal enhancing systems that amplify HRP activity

• Data analysis approaches:

  • Use advanced imaging systems with high dynamic range

  • Perform densitometry analysis with appropriate software

  • Always normalize to loading controls suitable for your experimental context

By implementing these optimized protocols, researchers can reliably detect CCZ1 even when expressed at low levels, enabling more accurate characterization of its role in various cellular processes.

What are the potential therapeutic implications of targeting CCZ1-dependent pathways?

Research targeting CCZ1-dependent pathways holds significant therapeutic promise across multiple disease areas:

• Antiviral therapeutics: CCZ1 inhibition nearly completely abolishes Marburg and Ebola infections and significantly reduces SARS-CoV-2 infection. This suggests that:

  • CCZ1 could serve as a host-directed therapeutic target for broad-spectrum antiviral development

  • Small molecule inhibitors of CCZ1 might provide protection against multiple viruses that rely on similar entry pathways

  • Targeting CCZ1-dependent trafficking could have advantages over virus-directed therapies in terms of reduced emergence of resistance

• Autoimmune disease intervention: Given the connections between endosomal trafficking and immune cell function, modulating CCZ1 pathways could potentially impact:

  • Aberrant B cell activation in autoimmune conditions

  • Antigen presentation dynamics in inflammatory disorders

  • Cytokine production and secretion mechanisms

• Challenges and considerations:

  • As CCZ1 regulates fundamental cellular processes, complete inhibition may cause undesirable side effects

  • Tissue-specific targeting approaches may be necessary

  • Therapeutic window determination will be critical for clinical translation

• Current limitations:

  • "It is important to emphasize that currently there are no available drugs specifically designed for this purpose"

  • Further research is needed to translate mechanistic insights into viable therapeutic strategies

How might single-cell analysis techniques enhance our understanding of CCZ1 function?

Incorporating single-cell analysis techniques could revolutionize our understanding of CCZ1 function in several ways:

• Heterogeneity mapping: Single-cell RNA-seq combined with CCZ1 antibody-based protein detection can reveal:

  • Cell-specific expression patterns of CCZ1 and associated trafficking machinery

  • Correlation between CCZ1 expression levels and susceptibility to viral infection

  • Identification of compensatory mechanisms in cells with naturally low CCZ1 expression

• Spatial transcriptomics and proteomics: These techniques could:

  • Map CCZ1 distribution within complex tissues like liver and vasculature

  • Identify microenvironmental factors influencing CCZ1 function

  • Reveal tissue-specific interaction networks

• Live-cell dynamics: Advanced microscopy with fluorescently labeled antibodies or tags can:

  • Track CCZ1 trafficking in real-time during viral entry

  • Measure kinetics of endosomal maturation in different cell types

  • Correlate CCZ1 activity with membrane remodeling events

• Multiparametric analysis: Combining CCZ1 detection with markers for endosomal compartments, viral components, and cellular stress responses would enable:

  • Comprehensive mapping of CCZ1's role in the endolysosomal system

  • Identification of critical thresholds for CCZ1 function

  • Development of predictive models for therapeutic intervention

These advanced approaches would significantly enhance our mechanistic understanding of CCZ1's role in both normal cell physiology and pathological conditions.