CD55 Antibody

What is CD55 and why are antibodies against it important in research?

CD55, also known as Decay Accelerating Factor (DAF), is a 41.4 kDa glycosylphosphatidylinositol (GPI)-anchored surface glycoprotein that functions as a complement regulatory protein. It recognizes C4b and C3b fragments and prevents the formation of C3 and C5 convertases, thereby inhibiting complement activation . CD55 antibodies are crucial for studying complement regulation, immune responses, and various disease mechanisms including cancer, infectious diseases, and autoimmune disorders. The protein exists in multiple isoforms, with the canonical form comprising 381 amino acid residues . CD55 is widely distributed on blood cells, epithelial cells, and endothelial cells, making it an important target in various research fields .

What are the common applications for CD55 antibodies?

CD55 antibodies are utilized across multiple experimental techniques:

For reliable results, validation in your specific experimental system is recommended as optimal dilutions may vary based on antibody clone and sample type .

How can I verify the specificity of a CD55 antibody?

Verification of CD55 antibody specificity requires a multi-faceted approach:

• Positive and negative controls: Use cells known to express CD55 (e.g., HeLa, A549) versus those with low expression (e.g., MOLT-4) . Additionally, CD55-null cells from Inab phenotype individuals provide excellent negative controls .

• Knockdown/knockout validation: Compare staining patterns between wild-type and CD55 CRISPR-knockout cells. Research has validated antibodies using CD55-null cells generated through CRISPR-Cas9 genome editing .

• Peptide competition assay: Pre-incubate the antibody with the immunizing peptide to confirm signal abolishment.

• Cross-validation: Compare staining patterns across multiple anti-CD55 antibodies targeting different epitopes.

• Western blot analysis: Confirm detection of bands at expected molecular weights (typically 60-80 kDa for glycosylated CD55, though the calculated MW is 41.4 kDa) .

What is the difference between polyclonal and monoclonal CD55 antibodies?

When selecting between these antibody types, consider your experimental goals, required specificity, and intended applications .

What are the optimal storage and handling conditions for CD55 antibodies?

Proper storage and handling of CD55 antibodies are critical for maintaining activity:

Following manufacturer-specific recommendations is essential, as formulations may vary between suppliers .

How do I troubleshoot weak or non-specific signals when using CD55 antibodies?

When encountering issues with CD55 antibody staining, consider these methodological solutions:

For optimal results, perform titration experiments to determine the ideal antibody concentration for your specific application and sample type .

How should I select between different anti-CD55 antibody clones for my experiment?

Selection of appropriate anti-CD55 antibody clones depends on your experimental goals:

• Epitope considerations: Different clones target distinct CD55 domains:

  • N-terminal region (aa 51-79) antibodies for studying the functional domain

  • SCR4 domain antibodies (e.g., MEM-118) for specific structural studies

  • Consensus region 3 antibodies (e.g., BRIC216) for functional blocking experiments

• Application-specific performance:

  • For WB: Consider antibodies validated for glycosylated CD55 detection (60-80 kDa bands)

  • For IHC: Select clones with demonstrated performance on FFPE tissues

  • For blocking studies: Choose functionally validated antibodies like BRIC216

• Species reactivity: While most CD55 antibodies target human CD55, some cross-react with mouse or rat orthologs .

• Validated cell types: Confirm the antibody has been tested on your cell/tissue type of interest. Common positive controls include HeLa, A549, and placenta tissue .

• Functional vs. detection purposes: For functional studies, select antibodies known to block CD55 activity, whereas for localization studies, prioritize antibodies with strong signal-to-noise ratios .

Review available literature and validation data for each clone to make an informed selection aligned with your specific research needs .

How can CD55 antibodies be utilized in cancer research?

CD55 antibodies have significant applications in cancer research due to CD55 overexpression in various tumors:

• Detection of CD55 overexpression: CD55 is overexpressed in multiple solid and liquid tumors, functioning to protect tumor cells from complement-mediated cytotoxicity . Antibodies can help quantify and localize this overexpression in tissues and cell lines.

• Therapeutic development: Radiolabeled anti-CD55 antibodies show promise as theranostic agents. The lutetium-177-labeled anti-CD55 antibody (177Lu-anti-CD55) demonstrates therapeutic potential against pleural metastatic lung cancer, reducing tumor growth and enhancing survival in mouse models .

• Combination therapy studies: 177Lu-anti-CD55 enhances the antitumor activity of cisplatin both in vitro and in vivo, suggesting potential in combination therapy research .

• Biomarker development: CD55 expression analysis using antibodies helps identify patients who might benefit from complement-targeting therapies. In non-small cell lung cancer, CD55 is overexpressed in 76.47% of tissue specimens .

• Mechanism studies: Anti-CD55 antibodies help elucidate how CD55 promotes tumor progression through processes including neoangiogenesis, tumorigenesis, invasiveness, and evasion of apoptosis .

Methodologically, researchers should employ multiple antibody-based techniques (IHC, IF, flow cytometry) for comprehensive characterization of CD55's role in cancer biology .

What methodologies are available for studying CD55's role in malaria parasite invasion?

CD55 serves as a receptor for Plasmodium falciparum invasion of erythrocytes, and several antibody-based methodologies have been developed to study this process:

• Antibody-based invasion inhibition assays:

  • Polyclonal antibodies against CD55 ectodomain demonstrate dose-dependent inhibition of P. falciparum growth, with ~40% reduction in relative parasitemia at 400 μg/ml .

  • This approach allows quantification of CD55's functional contribution to parasite invasion.

• CRISPR-Cas9 knockout validation:

  • CD55-null erythrocytes generated using CRISPR-Cas9 genome editing provide excellent models for studying invasion mechanisms .

  • CD55-specific sgRNAs (e.g., CD55-Cr1 targeting exon 1 and CD55-Cr8 targeting exon 2) create CD55-knockout cells for invasion experiments .

• CD55 antibody specificity confirmation:

  • Flow cytometry using CD55-null RBCs from Inab donors validates antibody specificity .

  • This methodological control ensures that observed effects are due to CD55 blockade rather than non-specific binding.

• Cell maturity analysis in relation to invasion:

  • Combining CD55 antibodies with maturity markers (CD71, reticulocyte staining) helps determine how cell development stage influences CD55-dependent invasion .

  • This approach distinguishes between effects on reticulocytes versus mature erythrocytes.

These methodologies have revealed that CD55 mediates P. falciparum invasion, making it a potential target for antimalarial strategies .

How can CD55 antibodies be employed in studying complement regulation in disease models?

CD55 antibodies provide valuable tools for investigating complement regulation in various disease models:

• Functional blocking studies: Antibodies like BRIC216 that recognize the functional site of CD55 (consensus region 3) can block its complement-regulatory activity, allowing researchers to study the consequences of complement dysregulation in disease models .

• Cellular localization analysis: CD55 exists in multiple cellular locations, including membrane-bound forms (isoforms 1 and 7) and secreted forms (isoforms 3 and 5) . Antibodies help map this distribution in disease states:

  • Membrane localization: Typically visualized using non-permeabilized immunofluorescence

  • Secreted forms: Detected in biological fluids using ELISA or Western blotting

• Disease-specific expression profiling: CD55 plays contradictory roles across diseases - acting as a positive regulator in cancer and malaria but a negative regulator in CHAPLE syndrome, paroxysmal nocturnal hemoglobinuria, multiple sclerosis, and autoimmune diseases . Antibodies help characterize these context-dependent expression patterns.

• Therapeutic development evaluation: For diseases where CD55 augmentation could be therapeutic (CHAPLE syndrome, paroxysmal nocturnal hemoglobinuria, MS, autoimmune diseases), antibodies measure the efficacy of complement inhibition strategies .

• CD55-CD97 interaction studies: Antibodies targeting specific epitopes help investigate how CD55-CD97 interactions regulate T cells via complement-independent pathways, particularly relevant in autoimmune disease models .

These applications require careful selection of antibodies with appropriate epitope specificity and functional characteristics for the particular disease model under investigation .

What considerations are important when developing therapeutic CD55 antibodies?

Development of therapeutic CD55 antibodies presents several unique challenges and considerations:

• Context-dependent targeting strategy: CD55's role varies across diseases, requiring distinct therapeutic approaches:

  • For cancer and malaria: CD55-blocking antibodies may be beneficial

  • For CHAPLE syndrome, paroxysmal nocturnal hemoglobinuria, MS, and autoimmune diseases: CD55-augmenting strategies are needed

• Epitope selection complexity: Critical decisions include:

  • Functional domain targeting: Antibodies against consensus region 3 (e.g., BRIC216) can block CD55's complement-regulatory function

  • Isoform specificity: Targeting membrane-bound vs. secreted isoforms depending on therapeutic goals

  • Species cross-reactivity: Important for translational studies from animal models to humans

• Conjugation and modification strategies:

  • Radiolabeling approach: 177Lu-anti-CD55 antibody demonstrates therapeutic potential in cancer models

  • Conjugation chemistry: p-SCN-Bn-CHX-A"-DTPA conjugation protocol for radiolabeling has been established

  • Quality control: Immunoreactivity evaluation using Lindmo assay and Scatchard analysis ensures conjugated antibodies maintain target binding

• Specificity validation requirements:

  • CD55-null controls: Using cells from Inab phenotype individuals or CRISPR-knockout cells

  • Blocking assays: Competitive binding with excess unlabeled antibody to confirm specificity

  • Cross-reactivity screening: Ensuring minimal binding to other complement regulatory proteins

• Format considerations:

  • Fragment options: Single-chain variable fragments (scFvs) versus full IgG constructs

  • Chimeric approaches: Chicken/human chimeric antibodies have been successfully developed

These considerations are vital for developing CD55 antibodies with therapeutic potential across various disease contexts .

What is the recommended protocol for developing novel anti-CD55 antibodies?

Development of novel anti-CD55 antibodies can follow this established methodological framework:

• Library construction and screening:

  • Generate a phage-displayed antibody fragment library (e.g., scFv library) from immunized animals or naive sources

  • Perform biopanning with recombinant human CD55-coated magnetic beads

  • Select binding clones through multiple rounds of panning (typically four rounds)

  • Analyze binding reactivity using phage ELISA

• Conversion to full antibody format:

  • Isolate scFv clones with distinct HCDR3 sequences

  • Convert selected scFv clones to IgG form by combining variable regions with human constant regions

  • Clone into mammalian expression vectors encoding human IgG regions

• Production and purification:

  • Transfect constructs into mammalian cells (e.g., HEK293F)

  • Purify using protein A/G affinity chromatography followed by peptide affinity purification

• Characterization and validation:

  • Confirm binding specificity using flow cytometry with CD55-positive cells (e.g., H460) versus CD55-negative cells (e.g., H69)

  • Validate using Western blot against known CD55-expressing cell lines

  • Perform epitope mapping to determine binding regions

  • Test functionality in complement inhibition assays

This systematic approach has been successfully employed to develop novel anti-CD55 antibodies with therapeutic potential .

What are the optimal procedures for radiolabeling CD55 antibodies for theranostic applications?

Radiolabeling CD55 antibodies for theranostic applications follows this optimized protocol:

• Conjugation with chelator:

  • Incubate purified anti-CD55 antibody with 50-fold molar excess of p-SCN-Bn-CHX-A"-DTPA (B-355; Macrocyclics) in 0.1 mol/L NaHCO3 buffer (pH 8.2)

  • Purify conjugated antibodies using size-exclusion chromatography or dialysis

• Radiolabeling procedure:

  • Label p-SCN-Bn-CHX-A"-DTPA-conjugated anti-CD55 antibody with lutetium-177 (Lu-177 n.c.a.; half-life: 6.71 days) in 0.1 mol/L ammonium acetate buffer (pH 5.4)

  • Incubate for 30 minutes at room temperature

  • Purify labeled antibody using size-exclusion chromatography to remove unbound radioisotope

• Quality control methods:

  • Immunoreactivity assessment: Perform Lindmo assay by incubating varying concentrations of target cells (0 to 6.0 × 10^6) with 0.074 MBq of radiolabeled antibody for 1 hour

  • Binding specificity confirmation: Conduct blocking assays using 50X excess unlabeled antibody

  • Saturation binding analysis: Determine Kd values using Scatchard plots

  • Radiochemical purity: Analyze using instant thin-layer chromatography

• In vivo validation:

  • Characterize biodistribution in appropriate animal models

  • Compare tumor uptake versus normal tissue retention

  • Assess therapeutic efficacy through tumor growth inhibition studies

  • Evaluate survival benefit in disease models

This methodology has produced promising results with 177Lu-anti-CD55 antibody, demonstrating significant therapeutic potential in pleural metastatic lung cancer models .

How should CD55 knockout validation be performed when using anti-CD55 antibodies?

Rigorous validation of CD55 knockout models requires a systematic approach:

• CRISPR-Cas9 knockout strategy:

  • Design sgRNAs targeting CD55 exons (e.g., CD55-Cr1 targeting exon 1: GGGCCCCUACUCACCCCACA; CD55-Cr8 targeting exon 2: CUGGGCAUUAGGUACAUCUG)

  • Form ribonucleoprotein (RNP) complexes by adding 300 pmol of each sgRNA to 150 pmol Cas9 protein

  • Transfect target cells (e.g., CD34+ cells) using nucleofection (Lonza 4D-Nucleofector, program E0-100)

• Antibody-based validation methods:

  • Flow cytometry: Compare anti-CD55 antibody binding in wild-type versus knockout cells

  • Immunofluorescence microscopy: Assess membrane localization pattern in wild-type versus knockout cells

  • Western blotting: Confirm absence of CD55 protein bands in knockout lysates

• Functional validation approaches:

  • Complement sensitivity assays: Measure complement-mediated lysis susceptibility

  • Pathogen invasion studies: For erythrocytes, assess P. falciparum invasion rates

  • CD97 binding assays: Evaluate interaction with known CD55 binding partners

• Controls and considerations:

  • Inab phenotype samples: Natural CD55-null samples serve as excellent controls

  • Off-target effect analysis: Sequence potential off-target sites predicted by CRISPR design tools

  • Differentiation capacity: Ensure CD55 knockout doesn't affect differentiation potential in progenitor cells

  • Isoform assessment: Verify knockout affects all relevant CD55 isoforms

This comprehensive validation approach ensures that observed phenotypes can be confidently attributed to CD55 deficiency rather than technical artifacts or off-target effects .

What emerging applications of CD55 antibodies show the most promise for future research?

Several emerging applications of CD55 antibodies demonstrate significant potential for future research:

• Targeted cancer immunotherapies:

  • Development of CD55-targeting antibody-drug conjugates (ADCs)

  • Bispecific antibodies linking CD55-expressing tumor cells to immune effectors

  • Combination strategies with immune checkpoint inhibitors

• Infectious disease interventions:

  • Antibodies targeting CD55-pathogen interactions, particularly for malaria treatment

  • Development of soluble CD55 competitors as adjunctive therapy for P. falciparum infection

  • Diagnostic applications for pathogen-induced CD55 modulation

• Complement-modulating therapeutics:

  • Precision medicine approaches targeting CD55 in complement-mediated disorders

  • Context-specific CD55 modulation for CHAPLE syndrome and paroxysmal nocturnal hemoglobinuria

  • Novel antibody formats with enhanced tissue penetration for localized complement regulation

• Advanced imaging applications:

  • Development of anti-CD55 antibody-based imaging agents for tumor detection

  • Companion diagnostics to identify patients likely to respond to complement-targeting therapies

  • Multimodal imaging approaches combining radiolabeled CD55 antibodies with other modalities

• Extracellular vesicle research:

  • Utilizing CD55 antibodies to characterize and isolate specific subpopulations of extracellular vesicles

  • Studying CD55's role in intercellular communication via exosomes and microvesicles

These emerging areas require continued refinement of antibody technologies, including development of more specific clones, optimization of conjugation chemistries, and enhancement of in vivo stability and targeting .

How might advances in antibody engineering impact future CD55-targeted therapeutics?

Antibody engineering advances are poised to revolutionize CD55-targeted therapeutics through several mechanisms:

• Format diversification beyond conventional IgGs:

  • Single-domain antibodies (nanobodies) for enhanced tissue penetration

  • Bispecific formats targeting CD55 and complement components simultaneously

  • Smaller fragments (Fab, scFv) with improved pharmacokinetic properties for specific applications

• Enhanced effector function engineering:

  • Fc modifications to modulate complement activation and ADCC activity

  • Glycoengineering to optimize antibody effector functions

  • pH-sensitive binding to enhance tumor-specific targeting while minimizing on-target/off-tumor effects

• Advanced conjugation strategies:

  • Site-specific conjugation technologies beyond the p-SCN-Bn-CHX-A"-DTPA approach

  • Homogeneous antibody-drug conjugates with precise drug-antibody ratios

  • Novel radioisotope coupling methodologies beyond 177Lu for theranostic applications

• Multispecific targeting approaches:

  • Dual-targeting of CD55 and CD97 to block both complement regulation and complement-independent pathways

  • Tri-specific antibodies incorporating immune cell recruitment

  • Conditional activation strategies to enhance target selectivity

• In vivo persistence enhancement:

  • Half-life extension technologies (albumin binding, FcRn engineering)

  • Resistance to proteolytic degradation through strategic stabilizing mutations

  • Tissue-specific targeting moieties for localized delivery