CERCAM antibody-mediated studies revealed:
Proliferation: CERCAM overexpression increased bladder cancer cell viability by 42% (MTT assay) and DNA synthesis by 35% (EdU assay) .
Invasion: Transwell assays showed CERCAM-silenced cells exhibited 60% reduced invasiveness compared to controls .
| Parameter | CERCAM Overexpression | CERCAM Silencing |
|---|---|---|
| Cell Viability (MTT) | ↑ 42% | ↓ 38% |
| DNA Synthesis (EdU) | ↑ 35% | ↓ 29% |
| Invasion (Transwell) | ↑ 2.1-fold | ↓ 60% |
Subcutaneous xenograft models in nude mice demonstrated:
Tumor volume: CERCAM-silenced tumors were 55% smaller than controls at 28 days post-implantation .
Biomarker modulation: Reduced PCNA (proliferation marker) and Vimentin (epithelial-mesenchymal transition marker) expression in silenced tumors .
CERCAM antibodies helped uncover its role in PI3K/AKT pathway activation:
Phosphorylation: CERCAM overexpression increased AKT phosphorylation (Ser473) by 3.2-fold, reversed by PI3K inhibitor LY294002 .
Pathway cross-talk: CERCAM silencing reduced Twist and N-cadherin (metastasis promoters) while restoring E-cadherin (epithelial marker) .
| Reagent/Assay | Details |
|---|---|
| Anti-CERCAM Antibody | Rabbit polyclonal (Proteintech 16411–1-AP), 1:500 dilution for Western blot |
| Cell Lines | T24, UM-UC-3 bladder cancer cells |
| Animal Model | BALB/c nude mice, subcutaneous tumor implantation |
| Pathway Inhibitor | LY294002 (PI3K inhibitor), 20 µM concentration |
CERCAM (cerebral endothelial cell adhesion molecule) is a cell adhesion molecule that plays critical roles in multiple cellular processes. Research has shown that CERCAM is particularly significant in cancer biology, with evidence indicating its overexpression in bladder cancer tissues and its involvement in cancer cell proliferation, invasion, and tumor growth . Understanding CERCAM function is essential for elucidating mechanisms of cancer progression and identifying potential therapeutic targets. Recent studies have demonstrated that CERCAM alters the phosphorylation process of AKT and may interact with the PI3K/AKT signaling pathway, further highlighting its importance in cellular signaling networks .
CERCAM antibodies are available in multiple formats based on reactivity, host species, applications, and conjugation status. Researchers can select from antibodies with reactivity against human, mouse, or rat CERCAM depending on their experimental model . Host options typically include rabbit and mouse-derived polyclonal antibodies . Some popular CERCAM antibodies include rabbit polyclonal antibodies with reactivity against human and mouse CERCAM (e.g., ABIN1501882) that can be used for Western blot (WB), immunohistochemistry (IHC), and paraffin-embedded IHC applications . These antibodies come in various quantities, such as 100 μL or 400 μL, to accommodate different research needs .
For optimal Western blotting with CERCAM antibodies, researchers should follow these methodological guidelines: After standard protein extraction, separation by SDS-PAGE, and transfer to membranes, block with 5% non-fat milk in TBST for 1-2 hours at room temperature. Incubate with anti-CERCAM primary antibody (typically at 1:500 dilution for antibodies like 16411-1-AP from Proteintech) at 4°C for 24 hours . After washing with TBST, incubate with appropriate HRP-conjugated secondary antibody at 37°C for 1 hour . Following additional washes, visualize the protein bands using enhanced chemiluminescence (ECL) reagents and an automatic chemiluminescence imaging system such as Tanon 5200 . For normalization, antibodies against housekeeping proteins like β-actin (1:5000 dilution) can be used as loading controls . Quantification of bands should be performed using appropriate image analysis software.
Comprehensive validation of CERCAM antibodies is crucial for ensuring experimental reliability. Begin with positive and negative control samples – use tissues or cell lines known to express CERCAM (bladder cancer cell lines for positive controls) and those with minimal expression (normal bladder epithelial cells for negative controls) . Verify antibody specificity using multiple techniques: Western blot should show bands at the expected molecular weight; immunohistochemistry or immunofluorescence should demonstrate appropriate subcellular localization; knockdown or knockout models should show decreased signal . Cross-reactivity should be assessed by testing the antibody against closely related proteins. Additionally, employ different antibody clones targeting distinct epitopes of CERCAM to confirm results. Batch-to-batch consistency should be monitored by retaining reference samples for comparison when using new antibody lots.
Optimal conditions for CERCAM antibodies vary by application:
For Western blotting: Use dilutions ranging from 1:500 to 1:2000 depending on the specific antibody (e.g., 1:500 for 16411-1-AP from Proteintech), with overnight incubation at 4°C .
For immunohistochemistry (IHC): Typically use 1:100 to 1:200 dilutions with antigen retrieval (citrate buffer, pH 6.0) and overnight incubation at 4°C .
For immunofluorescence: Use 1:50 to 1:200 dilutions with 1-2 hour incubation at room temperature or overnight at 4°C.
For ELISA: Follow manufacturer recommendations, generally starting with 1:1000 dilution and titrating as needed for optimal signal-to-noise ratio.
Always perform antibody titration experiments to determine the optimal concentration for your specific experimental setup, tissue type, and detection system.
CERCAM contributes to cancer progression through multiple mechanisms, as evidenced by both in vitro and in vivo studies. Functionally, CERCAM overexpression markedly enhances bladder cancer cell viability, DNA synthesis, and cell invasion capabilities . At the molecular level, CERCAM overexpression significantly increases the expression of proliferation markers (PCNA), as well as proteins associated with epithelial-mesenchymal transition (EMT) including Vimentin, Twist, and N-cadherin, while decreasing E-cadherin and cleaved-caspase3 . This altered protein expression profile promotes cancer cell survival and invasiveness. The PI3K/AKT signaling pathway appears to be a critical mediator of CERCAM's oncogenic functions, as PI3K inhibitor LY294002 treatment impaired the promotive effects of CERCAM overexpression on bladder cancer cell proliferation and invasion . In animal models, CERCAM silencing suppressed the growth of subcutaneously implanted tumors, further confirming its role in promoting tumor development .
The interaction between CERCAM and the PI3K/AKT signaling pathway appears to be a critical mechanism underlying CERCAM's oncogenic functions. Research has demonstrated that CERCAM alters the phosphorylation process of AKT, suggesting direct or indirect regulation of this key signaling node . When bladder cancer cells overexpressing CERCAM were treated with the PI3K inhibitor LY294002, the treatment partially impaired the promotive functions of CERCAM overexpression on cancer cell proliferation and invasion . This indicates that the PI3K/AKT pathway is at least partially responsible for mediating CERCAM's effects. Mechanistically, while the exact interaction points have not been fully elucidated, it's possible that CERCAM either directly activates PI3K/AKT signaling components or indirectly influences the pathway by affecting upstream regulators or parallel signaling cascades. Additional research using CERCAM antibodies for co-immunoprecipitation studies could help identify direct interaction partners of CERCAM within this signaling network.
For effective multiplex immunofluorescence using CERCAM antibodies, careful experimental design is essential. Begin by selecting primary antibodies raised in different host species (e.g., rabbit anti-CERCAM with mouse anti-E-cadherin or other markers) to avoid cross-reactivity . Use fluorophore-conjugated secondary antibodies with well-separated emission spectra to minimize bleed-through. Consider sequential staining protocols, where you complete one round of primary-secondary antibody staining, fix with 4% paraformaldehyde, and proceed to the next marker. Tyramide signal amplification (TSA) can be employed for weak signals, which allows antibodies from the same host species to be used for different targets. Include appropriate controls: single-stained samples for each marker to establish spectral profiles, isotype controls, and samples with known expression patterns. For co-localization studies of CERCAM with EMT markers or PI3K/AKT pathway components, optimize antibody concentration ratios to ensure balanced signal intensity across all channels . Analysis should employ spectral unmixing algorithms and quantitative co-localization metrics.
Several approaches can be employed for manipulating CERCAM expression in experimental models, with selection depending on research objectives. For CERCAM overexpression, lentiviral vectors containing CERCAM-expressing plasmids have proven effective in bladder cancer cell lines . Target cells should be plated in 12-well plates (1 × 10^5 cells/well) and transduced with 5 MOI lentiviral particles using 8 μg/ml hexadimethrine bromide to enhance transduction efficiency . For CERCAM silencing, lentiviral vectors encoding small interfering RNAs targeting CERCAM (Lv-sh1-CERCAM/Lv-sh2-CERCAM) can be employed, with Lv-sh-NC as a negative control . The following primer sequences have been successfully used for CERCAM manipulation:
| Application | Forward Primer | Reverse Primer |
|---|---|---|
| qRT-PCR CERCAM | GAGCCCAGGTTCTACCCAGAT | GCAGAGTCTGATTGTTGGTCA |
| lv-CERCAM | ctaccggactcagatctcgagATGCGCGCTGCCCGCGCC | gtaccgtcgactgcagaattcCTAGAGCTCATCTCGGGGCTG |
| Lv-sh-NC | GATCCGTGAGCCTGCATGGGATGGATCTCGAGATCCATCCCATGCAGGCTCACTTTTTG | AATTCAAAAAGTGAGCCTGCATGGGATGGATCTCGAGATCCATCCCATGCAGGCTCACG |
Successful manipulation should be confirmed by qPCR and Western blotting . Stable cell lines can be established through antibiotic selection. For in vivo models, CERCAM-manipulated cells can be used in subcutaneous implant models in nude mice to evaluate effects on tumor growth .
Designing CERCAM antibodies with custom specificity profiles requires integration of computational modeling with experimental validation. Recent advances employ biophysics-informed models trained on phage display experimental data to predict and design antibodies with desired binding characteristics . This approach allows researchers to create antibodies with either specific high affinity for a particular target epitope or cross-specificity for multiple target ligands . The process begins with identifying different binding modes associated with various ligands. For generating highly specific antibodies against CERCAM, the energy functions associated with binding to CERCAM should be minimized while maximizing those associated with undesired targets . Conversely, for cross-specific antibodies, the energy functions for all desired targets should be jointly minimized . Experimental validation is critical for confirming computational predictions. This approach is particularly valuable when discriminating between very similar epitopes, such as closely related cell adhesion molecules, and can help overcome limitations in traditional selection methods that are restricted by library size and control over specificity profiles .
Several factors can contribute to false results when using CERCAM antibodies:
For false positives:
Cross-reactivity with similar proteins: Validate antibody specificity using knockout/knockdown controls or peptide competition assays
Non-specific binding: Optimize blocking conditions (try different blockers like 5% BSA, 5% normal serum, or commercial blockers)
Excessive antibody concentration: Perform titration experiments to determine optimal concentration
Secondary antibody cross-reactivity: Include controls with secondary antibody only
Endogenous peroxidase or phosphatase activity: Use appropriate quenching steps before antibody application
For false negatives:
Inadequate antigen retrieval: Optimize retrieval conditions (buffer composition, pH, duration)
Insufficient antibody concentration: Test higher concentrations or longer incubation times
Epitope masking: Try different antibody clones targeting different epitopes of CERCAM
Sample degradation: Ensure proper sample collection, fixation, and storage
Detection system sensitivity: Consider signal amplification methods (TSA, polymer-based detection)
To address these issues, always include positive and negative controls, perform technical replicates, and validate findings using complementary techniques such as qRT-PCR for CERCAM mRNA expression .
When faced with conflicting results from different CERCAM antibody clones, a systematic investigative approach is necessary:
First, assess the target epitopes of each antibody clone – differences might be explained by epitope accessibility or post-translational modifications affecting specific regions of CERCAM .
Evaluate the validation status of each antibody; prioritize results from antibodies with more extensive validation documentation.
Consider the specific application context – some antibodies perform better in certain applications (WB vs. IHC) due to differences in how the epitopes are presented .
Examine experimental conditions for each antibody (fixation methods, antigen retrieval, blocking solutions) as these can significantly impact antibody performance.
Validate findings with orthogonal methods that don't rely on antibodies, such as qRT-PCR for mRNA expression or functional assays .
Use genetic approaches (siRNA knockdown, CRISPR knockout) to confirm specificity of each antibody clone.
For critical findings, consider using multiple antibody clones targeting different epitopes and report convergent results.
When publishing, transparently document the specific antibody clones used, including catalog numbers, lot numbers, and dilutions to aid reproducibility.
Quantitative analysis of CERCAM expression in immunohistochemistry studies requires standardized methodology: