CFL1/CFL2 Antibody

What are CFL1 and CFL2 proteins and what is their functional significance in experimental models?

Cofilin-1 (CFL1) and cofilin-2 (CFL2) are essential regulators of actin dynamics that influence cell motility, division, and morphology. These proteins are members of the actin depolymerizing factor (ADF)/cofilin family that bind and depolymerize filamentous F-actin and inhibit the polymerization of monomeric G-actin in a pH-dependent manner . CFL1 is ubiquitously expressed (the non-muscle isoform), while CFL2 shows tissue-specific expression predominantly in skeletal muscle and heart .

In research contexts, these proteins are critical targets for investigation in multiple fields including:

• Cell biology (cytoskeletal remodeling studies)

• Cancer biology (cell migration and invasion mechanisms)

• Neuroscience (neuronal development and plasticity)

• Muscle biology (muscle formation and regeneration)

CFL1 and CFL2 serve as key players in various cellular processes, with dysregulation linked to pathological conditions such as cancer, neurodegenerative disorders, and muscular dystrophies .

What are the standard applications for CFL1/CFL2 antibodies in experimental protocols?

CFL1/CFL2 antibodies are versatile tools employed across multiple experimental applications:

When selecting application parameters, researchers should note that CFL1/CFL2 antibodies typically detect bands at approximately 19 kDa on Western blots, corresponding to the calculated molecular weight of these proteins . For immunofluorescence applications, CFL1/CFL2 proteins often show both cytoplasmic and nuclear localization patterns depending on cellular state and experimental conditions .

How should CFL1/CFL2 antibodies be stored and handled to maintain optimal reactivity?

Proper storage and handling are critical for maintaining antibody performance:

• Storage temperature: Store lyophilized antibodies at -20°C; after reconstitution, store at 4°C for short-term (1 month) or -20°C for long-term (up to 1 year)

• Buffer composition: Most CFL1/CFL2 antibodies are stored in PBS with 50% glycerol, 0.02% sodium azide, and sometimes 0.5% BSA

• Aliquoting: For antibodies stored at -20°C, aliquot to avoid repeated freeze-thaw cycles which can degrade antibody quality

• Working dilutions: Prepare fresh dilutions for each experiment rather than storing diluted antibody for extended periods

• Safety note: Many preparations contain sodium azide, which should be handled by trained staff only as it is classified as hazardous

For optimal stability, follow manufacturer-specific recommendations, as buffer components may vary between commercial preparations .

What methodological approaches optimize Western blot detection of CFL1/CFL2 proteins?

Optimizing Western blot protocols for CFL1/CFL2 detection requires attention to several key parameters:

Sample preparation:

• Lyse cells with buffer containing 20 mM Tris-Cl (pH 7.5), 150 mM NaCl, 1% SDS, 1% Triton X-100, and protease inhibitors (10 μg/ml leupeptin, 1 mM aprotinin, 1 mM PMSF)

• Centrifuge lysates at 14,000 × g at 4°C for 15 minutes to remove cellular debris

Gel electrophoresis:

• Use 5-20% SDS-PAGE gels for optimal separation

• Run at 70V (stacking gel) followed by 90V (resolving gel) for 2-3 hours

• Load 30 μg of protein per lane under reducing conditions

Transfer and detection:

• Transfer to nitrocellulose membrane at 150 mA for 50-90 minutes

• Block with 5% non-fat milk or 5% BSA in TBS for 1-1.5 hours at room temperature

• Primary antibody incubation: Use CFL1/CFL2 antibody at 0.5-1 μg/mL dilution overnight at 4°C

• Washing: Perform 4 washes with TBST (TBS with 0.1% Tween-20)

• Secondary antibody: Incubate with HRP-conjugated secondary antibody (1:3000-1:5000) for 1-1.5 hours at room temperature

• Develop using enhanced chemiluminescence detection reagents

For phospho-specific detection (such as with phospho-Y88 antibodies), use phosphatase inhibitors in lysis buffers and consider using BSA instead of milk for blocking to prevent interference with phospho-epitopes .

How can researchers distinguish between CFL1 and CFL2 isoforms in experimental systems?

Distinguishing between CFL1 and CFL2 isoforms requires strategic experimental approaches due to their high sequence homology:

Isoform-specific antibodies:

• Some antibodies are designed to recognize specific epitopes unique to either CFL1 or CFL2

• Validate specificity using tissues with known differential expression: CFL1 is ubiquitous while CFL2 is predominantly expressed in skeletal muscle and heart

Expression analysis:

• RT-PCR using isoform-specific primers can differentiate between CFL1 and CFL2 transcripts

• CFL2 shows two alternatively spliced variants (CFL2a and CFL2b) with different tissue distributions: CFL2b is predominantly expressed in skeletal muscle and heart, while CFL2a shows broader tissue distribution

Molecular weight differentiation:

• Although both have similar molecular weights (~19 kDa), careful optimization of gel conditions can sometimes resolve the slight differences

• 2D gel electrophoresis can separate the isoforms based on both molecular weight and isoelectric point differences

Tissue selection:

• For validation experiments, compare skeletal muscle tissue (high CFL2) with non-muscle tissues

• Mouse skeletal muscle tissue shows high CFL2 expression, making it useful for positive control

What are the critical considerations for immunofluorescence studies using CFL1/CFL2 antibodies?

Successful immunofluorescence studies with CFL1/CFL2 antibodies require attention to several experimental factors:

Fixation and permeabilization:

• Fix cells with 4% paraformaldehyde at room temperature for 30 minutes

• Permeabilize with 0.2% Triton X-100 for 10 minutes to allow antibody access to intracellular cofilin proteins

• For flow cytometry applications, fix with 4% paraformaldehyde and use appropriate permeabilization buffer

Blocking conditions:

• Block with 1% BSA for 30 minutes or 10% normal goat serum to reduce non-specific binding

Antibody incubation:

• Use CFL1/CFL2 antibodies at dilutions of 1:200-1:1000 for standard IF applications

• For co-localization studies with actin, combine CFL1/CFL2 antibody labeling with phalloidin staining (TRITC or FITC-labeled)

Visualization parameters:

• For dual labeling of CFL1/CFL2 and F-actin, use FITC-conjugated secondary antibodies (green) for cofilin detection and TRITC-labeled phalloidin (red) for F-actin visualization

• Examine using appropriate filter sets for the fluorophores employed

Controls:

• Include negative controls (omitting primary antibody)

• Use tissues or cell lines with known expression patterns as positive controls

What strategies effectively validate CFL1/CFL2 antibody specificity in diverse experimental models?

Comprehensive validation of CFL1/CFL2 antibodies is crucial for ensuring experimental rigor:

Genetic knockout/knockdown validation:

• Implement siRNA-mediated knockdown of CFL1/CFL2 and confirm decreased antibody signal

• The search results show successful validation using CFL2 siRNA at 50 nM concentration, which produced significant reduction in signal compared to scramble siRNA controls

• Western blot and RT-PCR should be performed in parallel to confirm knockdown at both protein and mRNA levels

Peptide competition assays:

• Pre-incubate the antibody with the immunizing peptide before application to samples

• Signal elimination confirms epitope-specific binding

• Most CFL1/CFL2 antibodies use synthetic peptides from internal regions of human cofilin for immunization

Multiple antibody validation:

• Compare results using different antibodies targeting distinct epitopes on the same protein

• Concordant results across antibodies increase confidence in specificity

Recombinant protein testing:

• Overexpress tagged recombinant CFL1/CFL2 and confirm antibody detection

• The search results describe using adenovirus vectors (like pAD/PL-DEST/CMV-GFP) for cofilin overexpression studies

Cross-species reactivity assessment:

• Test antibody performance across samples from different species

• Many CFL1/CFL2 antibodies show reactivity with human, mouse, and rat samples, allowing cross-species validation

How can researchers effectively design siRNA knockdown experiments for CFL1/CFL2 functional studies?

Designing robust siRNA knockdown experiments for CFL1/CFL2 requires systematic methodology:

siRNA design and selection:

• Target specific regions of CFL1 or CFL2 mRNA with minimal off-target effects

• Test multiple siRNA sequences at different concentrations

• From the search results, CFL2-1 siRNA at 50 nM showed optimal knockdown effects compared to other tested sequences

Delivery methods:

• Use Lipofectamine 2000 or similar transfection reagents for effective delivery to adherent cells

• For primary cells or difficult-to-transfect lines, consider viral vector delivery systems

• The search results describe successful construction of adenoviral vectors (pAD/PL-DEST/CMV-GFP/U6-shCFL) for cofilin knockdown

Validation protocol:

• Confirm knockdown efficiency by both:

  • RT-PCR for mRNA levels (reference gene: GAPDH)

  • Western blot for protein levels (reference protein: GAPDH)

• Assess time-dependent knockdown effects (examine at multiple timepoints)

Functional assessments:

• Examine actin dynamics using phalloidin staining

• Assess cell morphology, migration, and division capabilities

• For muscle-specific studies, evaluate differentiation markers in CFL2 knockdown experiments

Rescue experiments:

• Perform rescue experiments by expressing siRNA-resistant CFL1/CFL2 constructs

• This confirms phenotype specificity and rules out off-target effects

What methodological approaches are most effective for studying phosphorylation regulation of CFL1/CFL2 in experimental systems?

Analyzing cofilin phosphorylation state requires specialized experimental approaches:

Phospho-specific antibodies:

• Use phospho-specific antibodies such as CFL1/CFL2 (phospho Y88) antibody

• These antibodies recognize only the phosphorylated form of cofilin at specific sites

• Recommended dilution for immunohistochemistry: 1:50-1:100

Sample preparation considerations:

• Include phosphatase inhibitors in lysis buffers to preserve phosphorylation status

• Use freshly prepared samples whenever possible to minimize dephosphorylation

• For Western blot, prepare samples in buffer containing phosphatase inhibitors

2D gel electrophoresis:

• Separate phosphorylated and non-phosphorylated forms based on charge differences

• The search results indicate dephosphorylated CFL2 is the major isoform at later stages of muscle regeneration

Functional correlation:

• Correlate phosphorylation status with cellular functions

• In muscle regeneration models, dephosphorylated CFL2 predominates during later stages of regeneration and in dystrophin-deficient muscles of Duchenne muscular dystrophy patients

Phosphorylation manipulation:

• Use phosphatase or kinase inhibitors to manipulate phosphorylation status

• Create phosphomimetic (e.g., S3D) or non-phosphorylatable (e.g., S3A) mutants for functional studies

What approaches are most effective for investigating epigenetic regulation of CFL1/CFL2 expression?

Investigating epigenetic regulation of CFL1/CFL2 genes requires specialized methodologies:

DNA methylation analysis:

• Perform bisulfite sequencing PCR (BSP) to analyze methylation patterns of CFL1/CFL2 gene promoters

• The search results describe BSP amplification techniques to study CFL1 gene regulation during bovine myogenesis

• COBRA (Combined Bisulfite Restriction Analysis) technique can be used to assess methylation levels by combining bisulfite conversion with restriction digestion

Primer design for methylation studies:

• Design primers specific to bisulfite-converted DNA sequences

• Example of primers used for CFL1 methylation studies from the search results :

  • CFL1-DMR-F: TGTTTTAATAAGGATATTTAGGGTATTT

  • CFL1-DMR-R: CTCAATAAAAAACTACAACTCAACC

miRNA regulation analysis:

• Identify potential miRNA binding sites in CFL1/CFL2 3'UTR regions

• Construct luciferase reporter vectors containing wild-type or mutated miRNA binding sites

• The search results describe experimental validation of bta-miR-182 regulation of CFL1 expression

• Construction of vectors like psiCHECK-2-CFL1-wild and psiCHECK-2-CFL1-mutated for luciferase assays

Correlation studies:

• Correlate DNA methylation levels with gene expression data

• The search results indicate high DNA methylation levels corresponded with low CFL1 expression levels

Chromatin immunoprecipitation (ChIP):

• Use ChIP to analyze histone modifications at CFL1/CFL2 gene loci

• Combine with sequencing (ChIP-seq) for genome-wide analysis of regulatory elements

This methodological approach provides comprehensive insight into the epigenetic mechanisms controlling CFL1/CFL2 expression in different developmental and pathological contexts.

What are the optimal experimental controls for CFL1/CFL2 antibody-based studies?

Implementing appropriate controls is essential for robust CFL1/CFL2 antibody-based experiments:

Positive controls:

• For Western blot: Include cell lines or tissues with known high expression

  • Human: Jurkat cells, HeLa cells, liver tissue

  • Mouse: Skeletal muscle tissue, liver tissue, NIH/3T3 cells

  • Rat: C6 cells, heart tissue

• For IHC/IF: Human skeletal muscle tissue or heart tissue (high CFL2 expression)

Negative controls:

• Omit primary antibody while maintaining all other steps

• Use isotype control antibodies (e.g., rabbit IgG at equivalent concentration)

• For flow cytometry: Include unlabeled samples without primary and secondary antibodies

Knockdown/knockout controls:

• Include samples with siRNA-mediated reduction of target protein

• The search results confirm successful knockdown of CFL2 using siRNA approaches

Loading controls:

• For Western blot: GAPDH is commonly used as a reference protein

• For RNA studies: GAPDH or U6 for normalization of expression data

Cross-reactivity controls:

• Test antibody against recombinant CFL1 and CFL2 to assess specific vs. dual reactivity

• This is especially important for antibodies claiming to detect both isoforms

How should researchers address discrepancies in CFL1/CFL2 antibody performance across different experimental techniques?

When facing inconsistent antibody performance across techniques, follow this systematic troubleshooting approach:

Technique-specific optimization:

• Different applications may require different epitope accessibility conditions

• Western blot: Denaturing conditions may expose epitopes hidden in native conformations

• IF/IHC: Fixation and permeabilization methods affect epitope accessibility

Application-specific dilution adjustment:

• WB typically requires higher dilutions (1:500-1:3000)

• IHC may require more concentrated antibody (1:50-1:500)

• IF applications generally use intermediate dilutions (1:200-1:1000)

Sample preparation variations:

• Western blot: Adjust reducing conditions, detergent concentration, or heat denaturation

• IHC: Compare different antigen retrieval methods

  • Consider TE buffer (pH 9.0) or citrate buffer (pH 6.0) as suggested in search results

Lot-to-lot variations:

• Document lot numbers and compare performance

• Consider validating new lots against previously verified lots

Species cross-reactivity differences:

• An antibody may perform well in one species but poorly in another

• Verify antibody performance in your specific species of interest

Cell/tissue-specific factors:

• Expression levels vary across tissues (CFL2 highest in muscle tissues)

• Post-translational modifications may differ between tissues or experimental conditions

What methodological approaches help distinguish between CFL1/CFL2 antibody specificity issues and biological variations?

Distinguishing antibody technical limitations from true biological variations requires rigorous methodology:

Multiple antibody comparison:

• Use antibodies from different vendors targeting different epitopes

• Concordant results across antibodies suggest biological rather than technical variation

• Discordant results may indicate antibody specificity issues

Correlation with mRNA expression:

• Perform parallel protein (antibody-based) and mRNA (PCR-based) analyses

• Concordant changes suggest true biological variation

• Discordant results prompt further investigation of post-transcriptional regulation or antibody issues

Intervention studies:

• Manipulate biological conditions expected to alter CFL1/CFL2 expression

• Examples from search results include muscle regeneration models and differentiation studies

• Expected directional changes support antibody specificity

Mass spectrometry validation:

• Use unbiased proteomics to verify antibody-detected changes

• Particularly valuable for confirming isoform-specific identifications

Genetic manipulation controls:

• Overexpression systems with tagged constructs can verify antibody detection capability

• Knockdown systems confirm signal specificity

• The search results describe successful CFL2 knockdown validation experiments

By implementing these methodological approaches, researchers can confidently distinguish between technical limitations of antibodies and true biological variations in their experimental systems.