CHCHD4 Antibody

What is CHCHD4 and what are its key characteristics?

CHCHD4 is a 142-amino acid protein with a predicted molecular weight of 15,996 daltons, although it may appear at approximately 22 kDa in some assay conditions . It is primarily localized to the mitochondria and functions as a mitochondrial intermembrane space import and assembly protein . CHCHD4 is also known as MIA40 in the scientific literature . The protein is encoded by the human gene CHCHD4 (Gene ID: 131474) and has been studied across multiple species including human, mouse, and rat models .

What applications are CHCHD4 antibodies validated for?

CHCHD4 antibodies have been validated for multiple experimental applications, with strong performance in various techniques. Western Blot (WB) is the most commonly used application, with recommended dilutions typically ranging from 1:500-1:4000 . Other validated applications include:

• Immunohistochemistry (IHC): Typically at 1:50-1:500 dilution

• Immunofluorescence (IF)/Immunocytochemistry (ICC): Usually at 1:50-1:500 dilution

• Immunoprecipitation (IP): 0.5-4.0 μg for 1.0-3.0 mg of total protein lysate

• Co-immunoprecipitation (CoIP): For protein-protein interaction studies

• ELISA: For quantitative protein detection

The validation status varies by antibody source, so researchers should check specific product documentation for detailed application information.

How should CHCHD4 antibodies be stored and handled for optimal performance?

Most CHCHD4 antibodies require storage at -20°C for long-term stability (typically one year from shipment) . The antibodies are generally supplied in liquid form containing PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 . For short-term storage and frequent use, antibodies can be stored at 4°C for up to one month . It is crucial to avoid repeated freeze-thaw cycles as this can compromise antibody activity and specificity. Some manufacturers recommend aliquoting the antibody upon receipt to minimize freeze-thaw cycles .

What are the recommended dilutions and conditions for Western blot detection of CHCHD4?

For Western blot applications, CHCHD4 antibodies typically perform optimally at dilutions between 1:500-1:4000 . The observed molecular weight of CHCHD4 in Western blots is approximately 22 kDa, which differs slightly from its calculated molecular weight of 15,996 daltons . This difference may be due to post-translational modifications or the physical properties of the protein.

When designing Western blot experiments, researchers should:

• Use appropriate positive controls (for example, Daudi cells, human heart tissue, mouse lung tissue, and other validated samples mentioned in the literature)

• Optimize transfer conditions for small proteins

• Consider using PVDF membranes for better retention of smaller proteins

• Employ blocking solutions that minimize background while preserving specific binding

What controls should be included when using CHCHD4 antibodies?

When designing experiments with CHCHD4 antibodies, proper controls are essential for result interpretation:

• Positive controls: Tissues or cell lines with confirmed CHCHD4 expression, such as Daudi cells, human heart tissue, mouse lung tissue, mouse spleen tissue, L02 cells, mouse kidney tissue, Ramos cells, Raji cells, rat brain tissue, and mouse brain tissue

• Negative controls:

  • Primary antibody omission control

  • Non-immune serum from the same species as the primary antibody

  • CHCHD4 knockout or knockdown samples where available

• Loading controls: For Western blots, include housekeeping proteins like actin as indicated in published protocols

• Specificity controls: Consider using blocking peptides when available to confirm signal specificity

How can I optimize immunohistochemistry protocols for CHCHD4 detection?

For successful immunohistochemical detection of CHCHD4:

• Antigen retrieval: Use TE buffer at pH 9.0 as recommended, though citrate buffer at pH 6.0 may also be used as an alternative

• Antibody dilution: Start with 1:50-1:500 dilution range based on manufacturer recommendations

• Tissue preparation: Properly fixed and processed tissues are crucial; mouse testis tissue and human kidney tissue have been successfully used for CHCHD4 detection

• Detection system: Choose an appropriate detection system compatible with the primary antibody host species (typically rabbit or mouse for CHCHD4 antibodies)

• Counterstaining: Use appropriate nuclear counterstains that do not obscure the specific CHCHD4 signal

How can CHCHD4 antibodies be utilized to study the AIF-CHCHD4 interaction?

The interaction between CHCHD4 and Apoptosis-Inducing Factor (AIF) is physiologically significant, particularly in metabolic processes. Researchers interested in this interaction can:

• Use co-immunoprecipitation (CoIP) with CHCHD4 antibodies to pull down protein complexes and detect AIF as an interacting partner

• Employ immunofluorescence microscopy to study co-localization patterns of CHCHD4 and AIF in various cell types and conditions

• Design competition experiments using the N-terminal peptide of CHCHD4, which has been shown to disrupt the AIF-CHCHD4 interaction

• Consider proximity ligation assays to visualize and quantify the AIF-CHCHD4 interaction in situ

This approach is particularly valuable for researchers exploring the metabolic epistasis between these proteins, as heterozygous CHCHD4 mice (Chchd4+/-) demonstrate resistance to diet-induced obesity, suggesting therapeutic potential for targeting this interaction .

What methodological approaches can be used to study CHCHD4's role in metabolism?

CHCHD4's emerging role in metabolism offers several research avenues:

• Metabolic phenotyping of CHCHD4-deficient models:

  • Use heterozygous CHCHD4 (Chchd4+/-) mice, which show resistance to diet-induced obesity without obvious pathology

  • Compare metabolic parameters with wild-type controls using techniques such as indirect calorimetry, glucose tolerance tests, and insulin sensitivity assays

• Mechanistic studies:

  • Investigate mitochondrial respiratory chain function in CHCHD4-deficient models

  • Examine the activation of homeostatic pathways like the mitochondrial unfolded protein response that might be affected by CHCHD4 deficiency

  • Study the potential impact on p53 signaling pathways, as CHCHD4 can regulate p53 subcellular localization, which in turn controls white and brown fat cell differentiation

• Therapeutic targeting:

  • Explore small molecules that affect the AIF-CHCHD4 axis as potential therapeutic interventions for obesity and metabolic syndrome

How can CHCHD4 antibodies be used to investigate mitochondrial import mechanisms?

CHCHD4/MIA40 functions as a mitochondrial intermembrane space import and assembly protein. To study its role in mitochondrial import:

• Subcellular fractionation and immunoblotting:

  • Use CHCHD4 antibodies to detect the protein in various mitochondrial compartments

  • Compare import efficiency of mitochondrial proteins in models with different CHCHD4 expression levels

• Immunofluorescence microscopy:

  • Co-localize CHCHD4 with other mitochondrial import machinery components

  • Track protein import in real-time using fluorescently tagged substrate proteins

• Protein-protein interaction studies:

  • Employ CHCHD4 antibodies in immunoprecipitation experiments to identify novel interacting partners involved in the import process

  • Use crosslinking approaches combined with immunoprecipitation to capture transient interactions during import

Why might I observe different molecular weights for CHCHD4 in Western blots?

Researchers may observe CHCHD4 at different molecular weights than the calculated 15,996 daltons (16 kDa). The protein is often detected at approximately 22 kDa in Western blots . This discrepancy could be attributed to:

• Post-translational modifications: Various modifications can affect protein migration in gels

• Protein structure: The coiled-coil-helix-coiled-coil-helix domain structure may influence migration

• Technical factors:

  • Gel percentage and buffer composition

  • Running conditions and protein denaturation efficiency

  • Ladder calibration issues

To address this, researchers should:

• Include positive controls with known CHCHD4 expression

• Consider using multiple antibodies that recognize different epitopes

• Document the observed molecular weight in experimental conditions for consistent interpretation

How can non-specific binding be minimized when using CHCHD4 antibodies?

Non-specific binding can complicate interpretation of results when using CHCHD4 antibodies. To minimize this issue:

• Optimize blocking conditions:

  • Test different blocking agents (BSA, non-fat dry milk, commercial blockers)

  • Adjust blocking time and temperature

• Antibody dilution optimization:

  • Titrate antibody concentrations to find the optimal signal-to-noise ratio

  • Follow manufacturer's recommended dilution ranges (e.g., 1:500-1:2000 for WB, 1:100-1:200 for IHC)

• Washing optimization:

  • Increase washing duration or number of washes

  • Adjust detergent concentration in wash buffers

• Consider using antigen-purified antibodies which typically have higher specificity

• For immunohistochemistry applications, optimize antigen retrieval methods as recommended (TE buffer pH 9.0 or citrate buffer pH 6.0)

How should I interpret changes in CHCHD4 expression in disease or metabolic models?

When analyzing CHCHD4 expression in disease or metabolic models:

• Establish baseline expression levels in appropriate control samples across different tissues

• Consider the broader context of mitochondrial function:

  • Assess other mitochondrial proteins to determine if changes are specific to CHCHD4 or part of a broader mitochondrial response

  • Correlate expression changes with functional mitochondrial parameters

• Interpret results in light of metabolic phenotypes:

  • In metabolism studies, partial CHCHD4 deficiency (as in Chchd4+/- mice) confers resistance to diet-induced obesity without obvious pathology

  • This suggests that moderate changes in CHCHD4 levels may have beneficial metabolic effects while severe deficiency might be pathogenic

• Consider compensatory mechanisms:

  • Look for potential adaptive responses in related pathways

  • Examine temporal dynamics of expression changes

• For human samples, account for potential variations in CHCHD4 expression due to genetic factors, age, and other variables

What methods are available for genotyping CHCHD4 mutant models?

For researchers working with CHCHD4 animal models:

• PCR-based genotyping:

  • For heterozygous Chchd4 mice, DNA extraction from tail snips using appropriate kits (e.g., Maxwell16 mouse tail DNA purification kit)

  • PCR amplification using specific primers for wild-type and mutant alleles:

    • Wild-type allele: IST11943B12-F (TGGGCTGGTTAGTCAGTGATTGG) and IST11943B12-R (GTGCTCCTCATAGGGATCATTGG)

    • Mutant allele: IST11943B12-R and LTR2 (AAATGGCGTTACTTAAGCTAGCTTGC)

• Expected genotype distributions:

  • In breeding studies with Chchd4+/- mice, genotype distribution at weaning showed:

    • 44% wild-type

    • 56% Chchd4+/-

  • This distribution is documented in the following data from multiple crosses:

• Verification of CHCHD4 protein levels:

  • Western blotting using validated CHCHD4 antibodies to confirm protein expression levels in heterozygous models

  • Compare with appropriate wild-type controls from the same genetic background