chmp4c Antibody

What is CHMP4C and why is it important in cancer research?

CHMP4C is a component of the endosomal sorting complex required for transport III (ESCRT-III), which facilitates the necessary separation of daughter cells during cell division. Research has demonstrated CHMP4C's involvement in multiple cancers, including lung squamous cell carcinoma (LUSC), prostate cancer, and cervical cancer . CHMP4C regulates cell cycle progression, with dysregulation contributing to cancer development and progression. Studies indicate that CHMP4C is overexpressed in LUSC tissues compared to adjacent normal tissues, suggesting its potential as a diagnostic biomarker . Similarly, elevated CHMP4C expression in prostate cancer correlates with poor clinical prognosis and malignant progression .

What experimental approaches are recommended for detecting CHMP4C expression in clinical samples?

For reliable CHMP4C detection in clinical samples, a multi-modal approach is recommended:

• Protein level detection: Western blot analysis using validated CHMP4C antibodies (e.g., Abcam ab168205 as used in prostate cancer studies) .

• mRNA expression analysis: Quantitative RT-PCR using validated primers (e.g., CHMP4C-F: AGACTGAGGAGATGCTGGGCAA, CHMP4C-R: TAGTGCCTGTAATGCAGCTCGC) .

• Tissue expression patterns: Immunohistochemistry on formalin-fixed paraffin-embedded tissues.

When analyzing clinical samples, it is essential to include both tumor and matched normal tissues (located >2 cm from tumor margins) for comparative analysis. Studies have successfully detected CHMP4C overexpression in LUSC using this approach, confirming its differential expression patterns between cancerous and normal tissues .

How should Western blot conditions be optimized for CHMP4C detection?

Optimal Western blot conditions for CHMP4C detection include:

• Protein extraction: Use RIPA buffer with PMSF protease inhibitor to prevent protein degradation.

• Protein quantification: Employ BCA method for accurate protein concentration determination.

• Gel separation: 10% SDS/PAGE gels have shown optimal separation for CHMP4C.

• Membrane transfer: Transfer to PVDF membranes at appropriate voltage and time.

• Blocking: Block with 5% skim milk to reduce background.

• Primary antibody: Incubate with validated CHMP4C antibody (e.g., Abcam ab168205) overnight at 4°C.

• Detection: Use horseradish peroxidase-labeled secondary antibody and ECL luminescent reagent .

For consistent results, GAPDH (Abcam ab8245) serves as an effective internal control. This protocol has been validated in multiple studies examining CHMP4C expression in cancer cell lines and clinical samples .

How can researchers address discrepancies between CHMP4C protein and mRNA expression data?

Discrepancies between protein and mRNA expression levels may stem from post-transcriptional mechanisms affecting CHMP4C. To address these discrepancies:

• Simultaneous analysis: Perform parallel assessment of protein (Western blot) and mRNA (qRT-PCR) from the same samples.

• Time-course experiments: Investigate temporal dynamics of expression changes.

• Protein stability assays: Employ cycloheximide chase experiments to assess CHMP4C protein half-life.

• Translation efficiency analysis: Examine polysome profiles to evaluate translational control.

• miRNA regulation: Investigate potential miRNA-mediated repression of CHMP4C translation.

What experimental designs best evaluate CHMP4C's role in cell cycle regulation?

To investigate CHMP4C's involvement in cell cycle regulation, consider the following experimental approaches:

• Gene modulation studies:

  • siRNA knockdown (validated sequence: CCUGCGUCUCUACAACUAU)

  • Overexpression through plasmid transfection

  • CRISPR-Cas9 gene editing for complete knockout

• Cell cycle analysis:

  • Flow cytometry with propidium iodide staining

  • BrdU incorporation assays

  • Analysis of cell cycle checkpoint proteins (CDK2, CCNA2)

• Co-expression analysis:

  • Evaluate correlation with established cell cycle regulators

  • Perform Gene Set Enrichment Analysis (GSEA) to identify associations with cell cycle pathways

Research in prostate cancer cells demonstrated that CHMP4C co-expressed with key cell cycle genes and GSEA confirmed its involvement in cell cycle regulation . These findings highlight the importance of comprehensive approaches to fully characterize CHMP4C's role in cell cycle control across different cancer types.

How can researchers effectively evaluate CHMP4C as a diagnostic biomarker for cancer?

To assess CHMP4C's potential as a diagnostic biomarker, implement this systematic approach:

• Expression profiling:

  • Compare CHMP4C levels in tumor vs. normal tissues

  • Evaluate expression across cancer stages and grades

• Diagnostic performance evaluation:

  • Conduct Receiver Operating Characteristic (ROC) curve analysis

  • Calculate Area Under Curve (AUC) values

  • Determine sensitivity, specificity, precision, recall, and F1-score

• Validation strategy:

  • Perform five-fold cross-validation with logistic regression

  • Test in independent patient cohorts

  • Compare with established biomarkers

In LUSC research, CHMP4C demonstrated promising diagnostic potential with AUC values of 0.829 and 0.708 in TCGA and GSE19188 databases, respectively. Logistic regression models yielded an average AUC of 0.823 with impressive performance metrics (accuracy: 0.898, precision: 0.912, recall: 0.983, F1-score: 0.946) . These findings support CHMP4C's utility in distinguishing LUSC samples from normal controls.

What methodologies can assess CHMP4C's impact on tumor microenvironment and immune responses?

To investigate CHMP4C's influence on tumor microenvironment and immune responses:

• Tumor microenvironment analysis:

  • Calculate immune, stromal, and estimate scores using specialized R packages (e.g., estimate package)

  • Compare scores between CHMP4C-high and CHMP4C-low tumors

• Immune cell infiltration assessment:

  • Apply CIBERSORT deconvolution algorithm to analyze the composition of infiltrating immune cells

  • Correlate CHMP4C expression with specific immune cell populations

• Immune checkpoint analysis:

  • Evaluate correlation between CHMP4C and immune checkpoint genes

  • Set statistical thresholds (e.g., p<0.001) to identify significant associations

• Immunotherapy response prediction:

  • Use validation cohorts (e.g., GSE67501) to assess CHMP4C's predictive value for immunotherapy response

  • Employ the "pRRophetic" package to predict drug sensitivity based on CHMP4C expression

In prostate cancer research, low CHMP4C expression correlated with higher immune scores and better responses to immune checkpoint inhibitors targeting PD-1 and CTLA-4 . These findings demonstrate CHMP4C's potential role in modulating the immune microenvironment and influencing immunotherapy efficacy.

How can researchers integrate CHMP4C expression data with functional pathway analysis?

To connect CHMP4C expression with functional pathways:

• Differential gene expression analysis:

  • Group samples by CHMP4C expression levels

  • Identify differentially expressed genes using the "limma" package

  • Visualize results through heat maps

• Pathway enrichment analysis:

  • Perform Gene Ontology (GO) analysis to identify enriched biological processes

  • Conduct Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis

• Network analysis:

  • Construct protein-protein interaction networks

  • Identify hub genes and key regulators connected to CHMP4C

Research in prostate cancer revealed that CHMP4C-associated differential genes were primarily involved in immune function regulation, as demonstrated by both GO and KEGG analyses . This approach facilitates understanding of the broader molecular context in which CHMP4C operates, providing insights into its mechanistic role in cancer progression.

What are the critical considerations for validating CHMP4C antibody specificity?

To ensure CHMP4C antibody specificity:

• Positive and negative controls:

  • Use cell lines with known CHMP4C expression levels (e.g., prostate cancer: PC-3, DU-145; lung squamous carcinoma: NCI-H596, SK-MES-1, LK2, H520, SW900, LUDLU1)

  • Include normal cell lines as negative or low-expression controls (e.g., human normal lung cell line CCD-8L)

• Antibody validation experiments:

  • Perform knockdown/knockout studies to confirm signal reduction

  • Conduct peptide competition assays

  • Compare results from antibodies targeting different epitopes

• Cross-reactivity assessment:

  • Test in tissues known to not express CHMP4C

  • Evaluate potential reactivity with related CHMP family proteins

Validated CHMP4C antibodies (such as Abcam ab168205) have been successfully used across multiple cancer types , providing confidence in their specificity and reliability for detecting CHMP4C expression changes in experimental settings.

How should researchers approach CHMP4C knockdown experiments to ensure effective target modulation?

For successful CHMP4C knockdown experiments:

• siRNA design and validation:

  • Use validated siRNA sequences (e.g., si-CHMP4C: CCUGCGUCUCUACAACUAU) with appropriate controls (e.g., si-NC: CCUCUGGCAUUAGAAUUAUTT)

  • Test multiple siRNA constructs targeting different regions

  • Optimize transfection conditions for each cell line

• Knockdown verification:

  • Confirm mRNA reduction by qRT-PCR

  • Validate protein depletion by Western blot

  • Assess knockdown stability over the experimental timeframe

• Functional validation:

  • Monitor phenotypic changes (proliferation, migration, invasion)

  • Assess changes in relevant signaling pathways

  • Verify impact on cell cycle progression using flow cytometry

Studies in prostate cancer cells demonstrated that CHMP4C knockdown affected cell cycle progression, highlighting the importance of thorough validation when investigating CHMP4C's functional roles . Careful optimization of these techniques ensures reliable interpretation of experimental outcomes.

What approaches can resolve inconsistent CHMP4C staining patterns across different tissue samples?

To address variable CHMP4C staining patterns:

• Pre-analytical variables optimization:

  • Standardize tissue collection and fixation protocols

  • Optimize antigen retrieval methods (heat-induced vs. enzymatic)

  • Control fixation duration to prevent overfixation

• Antibody optimization:

  • Determine optimal antibody concentration through titration

  • Test multiple antibody clones targeting different epitopes

  • Evaluate staining patterns with polyclonal vs. monoclonal antibodies

• Detection system refinement:

  • Compare chromogenic vs. fluorescent detection methods

  • Optimize amplification systems for low-expressing samples

  • Consider automated staining platforms for consistency

• Quantification standardization:

  • Develop standardized scoring systems

  • Implement digital image analysis for objective quantification

  • Use internal reference controls on each slide

These approaches have facilitated consistent CHMP4C detection across diverse cancer tissues in multiple studies , enabling reliable comparison of expression patterns and correlation with clinical parameters.

How can researchers design experiments to investigate CHMP4C's potential as a therapeutic target?

To explore CHMP4C as a therapeutic target:

• Target validation studies:

  • Evaluate effects of CHMP4C modulation on cancer cell survival and proliferation

  • Assess impact on chemotherapeutic sensitivity and resistance mechanisms

  • Investigate the consequences of CHMP4C inhibition in normal vs. cancer cells

• Therapeutic strategy development:

  • Design small molecule inhibitors or peptide mimetics targeting CHMP4C

  • Explore PROTAC (Proteolysis Targeting Chimera) approaches for targeted degradation

  • Develop antibody-drug conjugates targeting cell-surface pathways influenced by CHMP4C

• Combination therapy evaluation:

  • Test CHMP4C inhibition with immune checkpoint inhibitors

  • Assess synergy with standard chemotherapies (e.g., paclitaxel, 5-fluorouracil)

  • Investigate interactions with targeted therapies (e.g., bortezomib)

Research in prostate cancer identified differential drug sensitivities based on CHMP4C expression, with high-CHMP4C tumors showing better responses to paclitaxel and 5-fluorouracil, while low-CHMP4C tumors responded better to bortezomib . These findings provide a foundation for developing personalized therapeutic approaches based on CHMP4C expression profiles.