CHRNA1 Antibody

Shipped with Ice Packs
In Stock

Description

Structure and Target Specificity

CHRNA1 encodes the α1 subunit of nAChR, a ligand-gated ion channel composed of five subunits (2α1, β1, δ, and γ/ε) . The CHRNA1 antibody primarily binds to extracellular epitopes, particularly the main immunogenic region (MIR) of the α1 subunit . This region is a key target for autoantibodies in MG, a neuromuscular disorder characterized by muscle weakness .

Research Applications

CHRNA1 antibodies are utilized across multiple experimental paradigms:

  • Western Blot (WB): Detects α1 subunits in rodent skeletal muscle (54 kDa) .

  • Immunohistochemistry (IHC): Labels neuromuscular junctions (NMJs) in human and mouse tissues .

  • Immunofluorescence (IF): Visualizes receptor clustering in cultured myoblasts (e.g., C2C12 cells) .

  • Disease Modeling: Used to induce experimental autoimmune myasthenia gravis (EAMG) in mice via CHRNA1 immunization, resulting in anti-AChR antibodies (60–3,740 pmol/L) and NMJ simplification .

Autoimmune Targeting in Myasthenia Gravis

  • Pathogenic Role: ~94% of MG patient autoantibodies target the α1 subunit’s extracellular domain . These antibodies cause receptor internalization, complement-mediated damage, and disrupted acetylcholine binding .

  • Therapeutic Models:

    • EAMG mice immunized with recombinant CHRNA1 show reduced NMJ density (≥50% loss) and simplified synaptic morphology .

    • Chimeric autoantibody receptor (CAAR) T cells engineered with α1 extracellular domains selectively eliminate anti-AChR B cells in vitro .

Toxin Interactions

CHRNA1 antibodies compete with α-bungarotoxin, a snake venom protein that irreversibly blocks nAChRs . This interaction is leveraged in toxin-neutralization assays.

Limitations and Considerations

  • Isoform Specificity: Some antibodies (e.g., MA3-043) cross-react with γ/δ subunits, complicating α1-specific detection .

  • Degradation Sensitivity: CAAR-T cells expressing α1 extracellular domains show reduced surface expression over time due to lysosomal degradation .

  • Tissue Specificity: α1 is exclusively expressed in muscle, unlike neuronal nAChR subunits .

Emerging Research Directions

  • Gene Editing: CRISPR-based modulation of CHRNA1 in iPSC-derived motor neurons to study congenital myasthenic syndromes .

  • Therapeutic Antibodies: Humanized monoclonal antibodies targeting the MIR for MG treatment are in preclinical trials .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Composition: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (12-14 weeks)
Synonyms
CHRNA1
Target Names
Uniprot No.

Q&A

What is CHRNA1 and what cellular structures does it mark in research applications?

CHRNA1 (Nicotinic Acetylcholine Receptor alpha 1/CHRNA1) is a protein subunit of the nicotinic acetylcholine receptor that plays a crucial role in neuromuscular transmission. Unlike other α subunits (α2-10) which are expressed in neuronal cells, the α1 subunit is specifically expressed in skeletal muscle tissue . The protein functions as part of heteropentameric receptors with the stoichiometry of (α1)₂β1δγ in fetal muscle cells and (α1)₂β1δε at mature neuromuscular synapses .

From a structural perspective, CHRNA1 contains a conserved large extracellular N-terminal domain, three conserved transmembrane domains, a variable cytoplasmic loop, and a fourth transmembrane domain with a short extracellular C-terminal domain . The extracellular domain is particularly important as it contains the main immunogenic regions and includes a Cys-loop that is required for acetylcholine binding . When studying cellular localization, CHRNA1 antibodies primarily mark neuromuscular junctions (NMJs) which typically appear as complex "pretzel"-like structures in healthy tissue .

What are the recommended applications and dilutions for CHRNA1 antibodies?

CHRNA1 antibodies have been validated for several experimental applications with specific recommended dilutions to optimize results:

ApplicationRecommended DilutionValidated Samples
Western Blot (WB)1:500-1:1000Mouse heart tissue, rat heart tissue
Immunohistochemistry (IHC)1:50-1:500Mouse skeletal muscle tissue, human heart tissue, human skeletal muscle tissue
Immunofluorescence (IF/ICC)1:50-1:500C2C12 cells

For immunohistochemistry applications, it's recommended to perform antigen retrieval with TE buffer at pH 9.0, though citrate buffer at pH 6.0 may serve as an alternative . When selecting positive controls, rat skeletal muscle and mouse C2C12 myoblasts have been validated for western blot analysis . For immunofluorescence studies of neuromuscular junctions, co-staining with α-bungarotoxin is commonly employed to visualize acetylcholine receptors at the NMJ .

How can I evaluate the specificity of a CHRNA1 antibody?

Evaluating antibody specificity is crucial for ensuring reliable experimental results. For CHRNA1 antibodies, several approaches are recommended:

First, perform western blot analysis using appropriate positive controls such as rat skeletal muscle or mouse C2C12 myoblasts . A specific CHRNA1 antibody should detect a band at the expected molecular weight. To further confirm specificity, conduct a blocking peptide experiment by pre-incubating the antibody with a CHRNA1-specific blocking peptide such as the Nicotinic Acetylcholine Receptor α1/CHRNA1 (extracellular) Blocking Peptide . Disappearance of the signal in the blocked sample compared to the unblocked antibody provides strong evidence of specificity.

For immunohistochemistry or immunofluorescence applications, include both positive controls (skeletal muscle tissue) and negative controls (either isotype controls or primary antibody omission) . Additionally, comparison of staining patterns with other established CHRNA1 markers, such as α-bungarotoxin which binds to acetylcholine receptors at the NMJ, can help confirm the specificity of your antibody .

What fixation and sample preparation methods work best for CHRNA1 detection?

Proper fixation and sample preparation are critical for optimal CHRNA1 detection. For immunohistochemistry of paraffin-embedded tissues, such as human prostate carcinoma tissue, CHRNA1 has been successfully detected using antibodies at a 1/50 dilution . When working with frozen sections, 8 μm cryostat sections are commonly used for immunofluorescence studies .

For cellular preparations, standard fixation/permeabilization solutions (such as those from Thermo Fisher Scientific) have proven effective . When studying intracellular components, cells should be treated with fixation/permeabilization solution for approximately 20 minutes, followed by washing with permeabilization buffer prior to antibody incubation .

For electron microscopy studies involving CHRNA1, tissues should be fixed in glutaraldehyde and 2% OsO₄, then dehydrated and embedded in epoxy resin 618 . Ultra-thin (60 nm) sections can be prepared using a microtome, followed by staining with saturated uranyl acetate and 1% lead citrate before analysis .

How can CHRNA1 antibodies be used in experimental autoimmune myasthenia gravis (EAMG) models?

CHRNA1 antibodies play a critical role in studying experimental autoimmune myasthenia gravis (EAMG), a valuable model for investigating autoimmune mechanisms at the neuromuscular junction. In EAMG research, CHRNA1 antibodies are used to:

  • Detect antibody-mediated and complement-mediated damage at neuromuscular junctions

  • Evaluate the density and morphological changes in NMJs

  • Quantify autoantibody responses against acetylcholine receptors

For establishing an EAMG model, researchers typically immunize mice (e.g., C57BL/6 strain) with recombinant CHRNA1 protein emulsified in phosphate-buffered saline and complete Freund's adjuvant . The protocol involves subcutaneous injections at multiple sites (flanks and tail base) with two immunization timepoints (e.g., at 8 and 12 weeks of age) .

To evaluate the model, CHRNA1 antibodies can be used in conjunction with other markers to assess neuromuscular junction integrity. Immunofluorescence staining typically combines α-bungarotoxin (which binds to AChRs) with antibodies against neurofilament light chain to visualize and quantify NMJs . EAMG progression can be monitored by analyzing the density of NMJs per high-power field and assessing their morphological complexity. In EAMG models, NMJs typically show simplified topography with loss of their normal "pretzel"-like structure .

What strategies can optimize CHRNA1 visualization at the neuromuscular junction?

Visualizing CHRNA1 at neuromuscular junctions requires specialized techniques for optimal results. Several strategies can enhance detection quality:

First, combine CHRNA1 antibodies with α-bungarotoxin staining, which specifically binds to acetylcholine receptors at the NMJ . This dual-labeling approach provides confirmation of CHRNA1 localization and enables assessment of receptor clustering. For comprehensive NMJ analysis, triple staining with CHRNA1 antibody, α-bungarotoxin, and an antibody against neurofilament light chain (NFL) allows simultaneous visualization of both pre- and post-synaptic components .

When quantifying NMJs, employ blinded scoring in randomly distributed high-power fields (approximately 0.16 mm²) . For each sample, analyze at least 10 high-power fields to ensure representative results. The complexity of NMJ morphology should be assessed based on their appearance, with healthy NMJs displaying a complex "pretzel"-like structure while simplified, less folded structures indicate potential pathology .

To enhance signal specificity, implement careful blocking steps and include appropriate controls. Use irrelevant antibody stains (either mouse/rabbit monoclonal/polyclonal isotype controls) as negative controls, and always include controls where the primary antibody is omitted . For optimal tissue preparation, 8 μm cryostat sections are recommended for immunofluorescence applications .

How can CHRNA1 antibodies be used to differentiate between fetal and mature neuromuscular junctions?

CHRNA1 antibodies can be valuable tools for distinguishing between fetal and mature neuromuscular junctions due to developmental changes in receptor composition. The nicotinic acetylcholine receptor undergoes a subunit switch during development, transitioning from a fetal form with the stoichiometry (α1)₂β1δγ to a mature form with the stoichiometry (α1)₂β1δε at adult neuromuscular synapses .

To differentiate between these developmental stages, researchers can use antibodies that specifically recognize epitopes present in either the γ or ε subunits in combination with CHRNA1 antibodies. For instance, antibodies targeting the extracellular domain of CHRNA1, such as those directed against the peptide sequence EHETRLVAKLFKD(C) (corresponding to amino acid residues 22-34 of rat nAChRα1), can be used alongside subunit-specific antibodies .

Morphological assessment provides another approach for developmental staging. Immature NMJs typically display simpler structures, while mature NMJs exhibit the characteristic complex "pretzel"-like morphology . Quantitative analysis of NMJ complexity, combined with subunit-specific immunolabeling, can provide robust differentiation between developmental stages.

For molecular confirmation, researchers can complement immunostaining with PCR analysis using primers specific for CHRNA1 and other subunit genes to verify expression patterns. The forward primer 5′TCATCATTCCCTGCCTGCTCTTCT3′ and reverse primer 5′TCTCTGCAATGTACTTCACGCCCT3′ have been validated for CHRNA1 detection .

What are the implications of CHRNA1 in hyperhidrosis research and how can antibodies aid this investigation?

Recent research has revealed unexpected roles for CHRNA1 in hyperhidrosis (excessive sweating), expanding the applications of CHRNA1 antibodies beyond traditional neuromuscular junction studies. In hyperhidrosis models, CHRNA1 has been found to influence sweat gland function through its ion channel properties .

CHRNA1 antibodies can be used to detect and quantify receptor expression in sweat glands using western blotting and immunohistochemistry. For western blot detection, antibodies such as the MA3-043 (Thermo Fisher) have been validated for detecting CHRNA1 protein expression changes in hyperhidrosis models . When investigating CHRNA1 expression at the transcript level, researchers can employ qPCR with validated primers (Forward: 5′TCATCATTCCCTGCCTGCTCTTCT3′, Reverse: 5′TCTCTGCAATGTACTTCACGCCCT3′) .

An important research application involves studying the effects of CHRNA1 modulators on hyperhidrosis. For example, the CHRNA1 antagonist cisatracurium has been shown to alleviate hyperhidrosis in mouse models, likely by blocking the ion channel function of CHRNA1 rather than altering its expression levels . To confirm the specificity of such effects, researchers can manipulate CHRNA1 expression using viral vectors for overexpression or siRNA-mediated knockdown in sweat glands, followed by antibody-based detection to confirm expression changes .

For functional studies, researchers can use CHRNA1-expressing cell lines (such as transfected HEK293 cells) to study ion channel functions and the effects of potential modulators . In these systems, CHRNA1 antibodies can help validate expression levels before proceeding with functional assays.

What approaches are recommended for detecting different CHRNA1 isoforms?

Detecting different CHRNA1 isoforms presents a significant challenge in research applications due to their structural similarities. The protein exists in multiple isoforms, with isoform 1 forming functional acetylcholine-gated cation-selective channels, while isoform 2 is non-functional and not integrated into operational channels .

To distinguish between these isoforms, researchers should consider epitope-specific antibodies. Antibodies targeting regions that differ between isoforms 1 and 2 are essential for specific detection. For western blotting applications, optimizing separation conditions (such as using gradient gels) may help resolve subtle size differences between isoforms.

For transcript-level analysis, isoform-specific primers can be designed for RT-PCR or qPCR assays. When analyzing at the protein level, techniques such as immunoprecipitation followed by mass spectrometry may provide definitive isoform identification. Additionally, functional assays can complement antibody-based detection since isoform 1 forms functional ion channels while isoform 2 does not .

When conducting research that may involve multiple isoforms, it's advisable to use multiple antibodies targeting different epitopes and to validate findings using complementary techniques such as RNA-seq for transcript analysis or functional assays to distinguish between active and inactive forms.

How can I address non-specific binding when using CHRNA1 antibodies?

Non-specific binding is a common challenge when working with CHRNA1 antibodies. Several strategies can help mitigate this issue:

First, optimize blocking conditions by testing different blocking agents (BSA, normal serum, commercial blocking buffers) and concentrations. For western blot applications, 5% non-fat dry milk or 3-5% BSA in TBST is typically effective . For immunohistochemistry or immunofluorescence, 5-10% normal serum (from the species in which the secondary antibody was raised) often provides adequate blocking .

Second, titrate antibody concentrations carefully. Starting with the manufacturer's recommended dilution range (1:500-1:1000 for WB, 1:50-1:500 for IHC and IF/ICC), perform a dilution series to identify the optimal concentration that maximizes specific signal while minimizing background .

Third, include appropriate controls in every experiment. Use blocking peptide controls where the primary antibody is pre-incubated with a specific blocking peptide to confirm signal specificity . Additionally, include isotype controls using irrelevant antibodies of the same isotype and concentration as your CHRNA1 antibody .

For persistent non-specific binding in tissue sections, try adjusting the fixation protocol or antigen retrieval methods. For CHRNA1, TE buffer at pH 9.0 is recommended for antigen retrieval, though citrate buffer at pH 6.0 can be used as an alternative .

What considerations are important when designing co-localization studies with CHRNA1?

Co-localization studies involving CHRNA1 require careful planning to obtain meaningful results:

First, select complementary markers that provide context for CHRNA1 localization. At neuromuscular junctions, α-bungarotoxin is an excellent partner for CHRNA1 antibodies as it binds specifically to acetylcholine receptors . For studying pre-synaptic components, consider antibodies against neurofilament light chain (NFL) .

Second, address potential cross-reactivity between antibodies. When using multiple primary antibodies, they should ideally be raised in different host species to allow for selective detection with species-specific secondary antibodies. If this is not possible, consider sequential staining protocols with adequate blocking steps between primary antibody applications.

Third, optimize fluorophore selection to minimize spectral overlap. Choose fluorophores with well-separated excitation and emission spectra when designing multiplexed experiments. Include single-stained controls to establish proper compensation settings during imaging.

Fourth, employ appropriate imaging techniques. Confocal microscopy is generally recommended for co-localization studies to minimize out-of-focus fluorescence. When quantifying co-localization, use established coefficients (e.g., Pearson's or Manders' coefficients) and analyze multiple fields (at least 10 high-power fields) for statistical robustness .

Finally, confirm co-localization findings using complementary approaches such as proximity ligation assays or co-immunoprecipitation when possible, particularly for novel protein-protein interactions involving CHRNA1.

How does sample preparation affect CHRNA1 epitope recognition?

Sample preparation substantially impacts CHRNA1 epitope recognition and should be tailored to the specific application and epitope being targeted:

For western blotting applications, the choice of lysis buffer can affect epitope preservation. When studying membrane proteins like CHRNA1, use buffers containing mild detergents (such as 1% Triton X-100 or RIPA buffer) to efficiently extract the protein while maintaining epitope integrity .

For immunohistochemistry and immunofluorescence, the fixation method critically influences epitope accessibility. Paraformaldehyde fixation (typically 4%) preserves most epitopes while maintaining tissue morphology . For certain epitopes, particularly those in the extracellular domain of CHRNA1, mild fixation or antigen retrieval may be necessary. For paraffin-embedded tissues, antigen retrieval with TE buffer at pH 9.0 is recommended, though citrate buffer at pH 6.0 serves as an alternative .

The specific epitope targeted by the antibody determines sensitivity to preparation methods. Antibodies directed against extracellular epitopes (like the peptide EHETRLVAKLFKD(C) corresponding to amino acids 22-34 of rat nAChRα1) may have different requirements than those targeting intracellular domains . When working with a new antibody, it's advisable to test multiple preparation methods to determine optimal conditions.

For frozen tissues, cryoprotection steps and section thickness (8 μm is commonly used) affect antibody penetration and signal quality . Regardless of the preparation method, including appropriate positive controls (such as skeletal muscle tissue) is essential for validating staining protocols.

How can CHRNA1 antibodies contribute to studying acetylcholine receptor clustering defects?

CHRNA1 antibodies are invaluable tools for investigating acetylcholine receptor clustering defects, which are implicated in several neuromuscular disorders. These antibodies enable visualization and quantification of receptor distribution patterns at the neuromuscular junction.

In healthy tissue, acetylcholine receptors containing CHRNA1 form dense clusters with a complex "pretzel"-like morphology at the neuromuscular junction . Disruption of this pattern often indicates pathological conditions. CHRNA1 antibodies, used in conjunction with α-bungarotoxin staining, allow researchers to assess both receptor density (quantity) and distribution pattern (quality) at the NMJ .

For quantitative analysis of clustering defects, researchers should analyze multiple parameters including: (1) the number of NMJs per high-power field, (2) the size and area of individual clusters, and (3) the complexity of the NMJ morphology . This multi-parameter approach provides a comprehensive assessment of potential clustering abnormalities.

In experimental models like EAMG, immunofluorescence studies using CHRNA1 antibodies reveal that autoimmune attacks lead to simplified NMJ topography with loss of the normal fold-like structure . Similarly, genetic models with mutations affecting clustering machinery can be evaluated using CHRNA1 antibodies to characterize the resulting phenotype.

For mechanistic studies investigating the molecular basis of clustering defects, CHRNA1 antibodies can be combined with antibodies against clustering-associated proteins (such as rapsyn, MuSK, or agrin) to assess co-localization patterns and identify potential disruptions in the clustering machinery.

What are the considerations when using CHRNA1 antibodies in different species?

When using CHRNA1 antibodies across different species, several factors must be considered to ensure reliable results:

First, evaluate sequence homology of the target epitope. CHRNA1 is relatively well-conserved across mammals, but specific epitopes may vary. For example, an antibody raised against the rat CHRNA1 peptide sequence EHETRLVAKLFKD(C) (amino acids 22-34) may have different affinities for human or mouse CHRNA1 depending on sequence conservation in this region .

Third, adjust protocols for species-specific considerations. Different fixation times, antigen retrieval methods, or antibody concentrations may be required when moving between species. For example, when working with human tissues, antigen retrieval may be more critical than with rodent tissues due to differences in fixation effects .

Fourth, consider including species-appropriate positive controls in each experiment. For western blot analysis, rat skeletal muscle and mouse C2C12 myoblasts have been validated as positive controls for certain CHRNA1 antibodies . For immunohistochemistry, mouse skeletal muscle tissue, human heart tissue, and human skeletal muscle tissue have been successfully used .

How can CHRNA1 antibodies be utilized in disease model validation?

CHRNA1 antibodies serve as essential tools for validating disease models, particularly those involving neuromuscular junction dysfunction or acetylcholine receptor abnormalities:

For experimental autoimmune myasthenia gravis (EAMG) models, CHRNA1 antibodies help validate the model by confirming several disease hallmarks. In properly established models, immunofluorescence studies using CHRNA1 antibodies should reveal: (1) reduced number of NMJs per high-power field, (2) simplified NMJ morphology with loss of the "pretzel"-like structure, and (3) evidence of antibody and complement deposition at the NMJ . Additionally, ELISA assays can detect anti-AChR antibodies in serum, with levels typically ranging from 60 to 3740 pmol/L in EAMG mice compared to 20 to 80 pmol/L in controls .

In hyperhidrosis models, CHRNA1 antibodies help validate the involvement of acetylcholine receptor signaling in the pathogenesis. Western blotting and qPCR using CHRNA1-specific antibodies and primers can confirm expression changes following genetic manipulation (overexpression or knockdown) . Functional validation often involves testing CHRNA1 antagonists like cisatracurium, which should alleviate hyperhidrosis symptoms by blocking ion channel function without altering CHRNA1 expression levels .

For transgenic models with CHRNA1 mutations, antibodies help confirm the expression pattern and subcellular localization of the mutant protein. Comparison with wild-type controls using quantitative immunofluorescence can reveal alterations in receptor distribution, density, or clustering that validate the model's relevance to the human condition being studied.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.