CHTOP Antibody

What is CHTOP and what cellular processes does it regulate?

CHTOP is a nuclear protein involved in multiple cellular functions:

• It functions as a component of the dynamic TREX mRNA export complex, coupling nuclear pre-mRNA processing with mRNA export

• It plays an important role in the ligand-dependent activation of estrogen receptor target genes and may contribute to the silencing of fetal globin genes

• CHTOP can bind to the 5-hydroxymethylcytosine (5hmC)-containing promoters and facilitate PRMT-1-mediated methylation of arginine 3 of histone H4 (H4R3)

• It promotes transcriptional activation of key genes involved in oncogenic processes, particularly in cancers such as glioblastoma and ovarian cancer

What types of CHTOP antibodies are currently available for research?

Several types of CHTOP antibodies have been developed for research:

• Based on clonality: Both polyclonal (such as PACO08094 and ABIN7112745) and monoclonal (such as KT64) antibodies are available

• Based on host species: Commonly produced in rabbit or rat host systems

• Based on conjugation:

  • Unconjugated antibodies for flexibility in detection methods

  • Conjugated versions including HRP, FITC, Biotin, and AbBy Fluor® 350 for direct detection applications

• Based on target epitopes: Antibodies targeting different amino acid regions such as AA 31-130, AA 71-120, and AA 179-248

What are the validated applications for CHTOP antibodies?

CHTOP antibodies have been validated for multiple research applications:

• Western Blotting (WB): For detecting CHTOP protein expression levels in cell and tissue lysates

• Immunohistochemistry (IHC): For visualizing CHTOP expression in tissue sections, including paraffin-embedded (IHC-p) and frozen sections (IHC-fro)

• Immunofluorescence/Immunocytochemistry (IF/ICC): For subcellular localization studies, showing partial colocalization with splicing factor Srsf2 in nuclear speckles

• ELISA: For quantitative detection of CHTOP in various sample types

• Immunoprecipitation (IP): For studying protein-protein interactions involving CHTOP

What is the typical expression pattern of CHTOP in normal versus diseased tissues?

CHTOP expression varies significantly between normal and diseased tissues:

• Normal ovarian tissues show weak expression of CHTOP

• Benign ovarian cancer tissues display increased expression compared to normal tissues

• Malignant ovarian cancer tissues exhibit the strongest CHTOP expression

• In cell lines, normal epithelial ovarian cells (HOSE) show significantly lower CHTOP expression compared to ovarian cancer cell lines (IGROV-1, SK-OV-3, and OV-90)

• Metastatic epithelial ovarian cancer cell lines (OV-90) and malignant epithelial ovarian cancer cell lines (SK-OV-3) demonstrate higher CHTOP expression than less aggressive cancer cell lines (IGROV-1)

How can researchers optimize CHTOP antibody specificity validation for challenging experimental contexts?

For rigorous validation of CHTOP antibodies, researchers should:

• Implement RNA interference controls:

  • Use multiple siRNA sequences targeting different regions of CHTOP mRNA

  • Compare knockdown efficiency through both Western blotting and immunofluorescence as demonstrated in ovarian cancer studies (siRNA1: CAGACAGAUCCCGAAACCAAUGAUU; antisense: AAUCAUUGGUUUCGGGAUCUGUCUG showed the most efficient knockdown)

• Perform cross-validation with multiple antibodies:

  • Use antibodies targeting different epitopes of CHTOP (N-terminal vs. C-terminal regions)

  • Compare antibodies from different host species (rabbit vs. rat) and different clonality (monoclonal vs. polyclonal)

• Include appropriate negative controls:

  • Non-specific immunoglobulin controls at equivalent concentrations

  • Tissue/cell samples known to be negative for CHTOP expression

• Validate across multiple techniques:

  • Compare protein detection between Western blotting, immunohistochemistry, and immunofluorescence

  • Confirm that signal intensity correlates with known expression levels across different cell lines (e.g., HOSE < IGROV-1 < SK-OV-3/OV-90)

What methodological considerations are critical when investigating CHTOP's role in the TREX complex?

When studying CHTOP in the TREX complex, researchers should consider:

• RNA-dependent vs. RNA-independent interactions:

  • Include experimental conditions with and without ribonuclease treatment

  • Note that CHTOP interactions with TREX components are largely RNA-independent, as ribonuclease treatment only modestly affects co-immunoprecipitation results

• Mutually exclusive protein interactions:

  • CHTOP and Alyref bind in a mutually exclusive manner to Uap56

  • CHTOP and Thoc5 bind in a mutually exclusive manner to Nxf1, though CHTOP, Thoc5, and Nxf1 can exist in a single complex

  • Design competition assays (e.g., using increasing concentrations of Gb1-Alyref to displace 35S-Gb1-Chtop from Gst-Uap56)

• Protein modification effects:

  • Consider the impact of arginine methylation on CHTOP's interactions

  • CHTOP binding to the NTF2-like domain of Nxf1 requires arginine methylation of CHTOP

• Complex assembly dynamics:

  • Investigate how Uap56 recruits both Alyref and CHTOP onto mRNA

  • Examine how both CHTOP and Alyref activate the ATPase and RNA helicase activities of Uap56

How does CHTOP contribute to cancer progression, and what experimental approaches best elucidate these mechanisms?

To investigate CHTOP's role in cancer progression:

What are the critical technical considerations when using CHTOP antibodies for co-immunoprecipitation studies?

For effective co-immunoprecipitation of CHTOP and its binding partners:

• Buffer optimization:

  • Consider using PBS with 0.02% Sodium Azide and 50% Glycerol at pH 7.3

  • Maintain proteins at -20°C and avoid freeze/thaw cycles to preserve antibody functionality

• RNA bridging considerations:

  • Include experimental conditions with and without RNase A treatment to distinguish direct protein-protein interactions from RNA-bridged associations

  • CHTOP co-immunoprecipitates with TREX components including Uap56 even in ribonuclease A-treated extracts

• Antibody selection:

  • Use antibodies validated specifically for immunoprecipitation applications

  • Consider antibody affinity and specificity, with immunogen affinity-purified antibodies preferred

  • Purity level should be ≥95% as determined by SDS-PAGE for optimal results

• Control strategies:

  • Include non-TREX mRNP binding proteins (e.g., Hnrnpa1) as negative controls

  • Use mass spectrometry analysis to identify multiple proteins that co-purify in vivo with biotinylated CHTOP

How can researchers effectively use CHTOP antibodies to study its epigenetic regulatory functions?

To investigate CHTOP's epigenetic roles:

• Chromatin immunoprecipitation (ChIP) approaches:

  • Design ChIP experiments to study CHTOP binding to 5hmC-containing promoters

  • Combine with sequential ChIP (ChIP-reChIP) to determine co-occupancy with other factors

• Methylation analysis:

  • Use antibodies against H4R3 methylation to investigate CHTOP's role in facilitating PRMT-1-mediated methylation

  • Correlate CHTOP binding with histone modification patterns

• Co-localization studies:

  • Employ high-resolution imaging to analyze nuclear localization and potential co-localization with splicing factors such as Srsf2 in nuclear speckles

  • Use specific markers for various nuclear compartments to understand CHTOP's spatial distribution

• Functional genomics integration:

  • Combine CHTOP antibody-based techniques with RNA-seq to correlate CHTOP binding with transcriptional outcomes

  • Integrate with methylation profiling data to understand the relationship between CHTOP, DNA methylation, and gene expression

Technical Notes for Researchers

When working with CHTOP antibodies for immunohistochemistry applications, researchers should follow this optimized protocol:

• Deparaffinize tissue slides in xylene and rehydrate in ethanol

• Perform antigen retrieval using 0.01 M sodium citrate in boiling water for 20 minutes

• Incubate with primary CHTOP monoclonal antibody for 1 hour at room temperature

• Apply secondary antibody for 30 minutes at room temperature

• Include control slides with non-specific immunoglobulin