CLDN4 Human

What is the structural composition of human CLDN4 and its role in tight junctions?

Human Claudin-4 (CLDN4) is a 209 amino acid multipass membrane protein containing four transmembrane segments that serves as a critical component of tight junctions in epithelial cells . CLDN4 plays a vital role in regulating tight junction structural and functional strand dynamics, contributing to epithelial barrier formation and maintenance .

Unlike some other claudins, CLDN4 cannot form tight junction strands independently but must integrate with existing claudin strands to modulate barrier properties . It functions by:

• Integrating into CLDN3 strands to modify localized tight junction characteristics

• Potentially co-assembling with CLDN8 to form anion-selective channels that convey paracellular chloride permeability

• Disrupting strand assembly of channel-forming claudins (CLDN2 and CLDN15) to inhibit cation conductance

This complex interaction pattern highlights CLDN4's role as a regulatory component that fine-tunes epithelial barrier properties rather than serving as a primary structural element.

How conserved is CLDN4 across species and what implications does this have for research models?

Human CLDN4 shares 83% amino acid sequence identity with mouse and rat CLDN4 , indicating significant evolutionary conservation that suggests functional importance across mammalian species. This high degree of homology has important methodological implications for research:

• Mouse models can generally provide relevant insights into human CLDN4 function

• Cross-reactive antibodies can be developed for translational studies

• Therapeutic approaches targeting conserved epitopes may translate between preclinical and clinical settings

The successful development of human-mouse cross-reactive monoclonal antibodies like 5D12 demonstrates the practical value of this conservation, allowing researchers to conduct meaningful preclinical studies with potential translational relevance to human conditions.

What post-translational modifications regulate CLDN4 function?

Phosphorylation represents a critical post-translational modification regulating CLDN4 function, particularly affecting paracellular epithelial permeability . Although the search results don't detail specific phosphorylation sites, this modification likely occurs on serine and threonine residues in CLDN4's cytoplasmic domains.

The functional consequences of CLDN4 phosphorylation include:

• Altered protein-protein interactions within tight junction complexes

• Modified barrier function and selective permeability

• Changes in subcellular localization and integration into tight junction strands

When designing experiments to study CLDN4 function, researchers should consider how signaling pathways that activate various kinases might impact CLDN4 phosphorylation status and subsequently affect experimental outcomes.

How is CLDN4 expression dysregulated in human epithelial cancers?

CLDN4 is frequently overexpressed in numerous epithelial malignancies including gastric, colorectal, pancreatic, and breast cancers . This dysregulation occurs through multiple mechanisms:

• Epigenetic alterations: Hypomethylation of the CLDN4 promoter DNA is associated with upregulation in several cancer types

• Inflammatory signaling: Inflammation related to infection and cytokine activity can increase CLDN4 expression

• Growth factor signaling: Various growth factors can modulate CLDN4 levels in tumor tissues

In liver fluke-associated cholangiocarcinomas (CCAs), high CLDN4 expression appears in both precancerous hyperplastic/dysplastic biliary epithelia and established tumors regardless of histological classification . This expression pattern suggests CLDN4 may be involved in both early carcinogenesis and cancer maintenance.

The consistent overexpression of CLDN4 across multiple cancer types has established it as a potential therapeutic target and biomarker for epithelial malignancies.

What contradictions exist in the literature regarding CLDN4's role in cancer progression?

The relationship between CLDN4 expression and cancer progression presents several paradoxical findings that researchers must navigate:

These contradictions likely reflect:

• Context-dependent roles in different cancer types

• Divergent functions based on subcellular localization (junction vs. non-junction CLDN4)

• Interactions with tissue-specific signaling networks

When designing experiments investigating CLDN4 in cancer, researchers should carefully consider these contradictions and clearly define the specific context of their study.

How does CLDN4 contribute to chemoresistance in epithelial tumors?

CLDN4 contributes to chemoresistance primarily through its barrier function, forming tight junctions that act as physical obstacles to drug penetration into tumors . This barrier function has several important implications for cancer therapy:

• Reduced intratumoral drug concentrations due to limited paracellular diffusion

• Compartmentalization of tumor tissue creating protected microenvironments

• Maintenance of cancer cell polarity potentially affecting drug uptake mechanisms

For researchers developing targeted therapies, these barrier properties present both a challenge and an opportunity. CLDN4-targeting approaches using agents like Clostridium perfringens enterotoxin (CPE) or antibodies may disrupt the barrier function, potentially enhancing the efficacy of conventional chemotherapeutics when used in combination therapy strategies.

What are the most effective techniques for quantifying CLDN4 expression in research samples?

Multiple complementary techniques can effectively quantify CLDN4 expression at different levels:

• Protein Detection Methods:

  • Immunohistochemistry (IHC): Optimal for visualizing CLDN4 distribution in tissue architecture; assessed by brown-membranous staining intensity

  • Immunofluorescence: Effective for subcellular localization studies in cell cultures, with specific staining typically observed at cell surface and cytoplasm

  • Western blotting: Suitable for quantitative protein analysis in cell and tissue lysates

• mRNA Expression Analysis:

  • qPCR: Using specifically designed human CLDN4 primers (e.g., Forward: AGTGCAAGGTGTACGACTCGCT, Reverse: CGCTTTCATCCTCCAGGCAGTT)

  • RNA-seq: For genome-wide expression pattern analysis

• Structural Analysis:

  • Cryo-EM: For high-resolution structural studies of CLDN4 complexes with binding partners

When selecting a method, researchers should consider:

• The specific research question (localization vs. quantity vs. structure)

• Sample type availability (fresh tissue, fixed samples, cell cultures)

• Required sensitivity and specificity

• Need for spatial information vs. bulk quantification

What approaches have been developed for targeting CLDN4 in experimental cancer therapy?

Several promising approaches for targeting CLDN4 in cancer therapy have been developed:

• Antibody-Based Approaches:

  • Monoclonal antibodies like 5D12, a rat anti-CLDN4 antibody that specifically recognizes the second extracellular domain of human CLDN4

  • Chimeric antibodies (e.g., xi-5D12) that activate Fc-γIIIa receptors, triggering antibody-dependent cellular cytotoxicity (ADCC) in CLDN4-expressing cells

  • Synthetic antibody fragments (sFabs) that bind human CLDN4 with high specificity

• Toxin-Based Strategies:

  • Clostridium perfringens enterotoxin (CPE), which naturally binds to CLDN4 and induces cell apoptosis

  • C-terminal binding domain of CPE (C-CPE) for targeted delivery of therapeutic agents

• RNA Interference:

  • siRNA-mediated suppression of CLDN4 expression, which has been shown to reduce cell migration and invasion in cholangiocarcinoma cell lines

The effectiveness of these approaches is evidenced by preclinical studies demonstrating that CLDN4-targeted therapies can significantly suppress tumor growth in mice bearing human colorectal and gastric tumors without apparent adverse effects like weight loss or liver and kidney damage .

What methodological challenges exist in developing CLDN4-specific antibodies for research applications?

Developing effective CLDN4-specific antibodies presents several technical challenges:

• Specificity Challenges:

  • Distinguishing CLDN4 from other claudin family members with similar structural features

  • Ensuring cross-reactivity with both human and mouse CLDN4 for translational research

  • Accessing conformational epitopes that may be hidden in membrane-embedded portions

• Functional Requirements:

  • Targeting the correct extracellular domain for therapeutic applications

  • Designing antibodies that recognize conformation-dependent epitopes

  • Balancing binding affinity with functional modulation of CLDN4 activity

• Production and Validation Obstacles:

  • Expressing properly folded CLDN4 for immunization protocols

  • Screening for antibodies that recognize native CLDN4 in cellular contexts

  • Validating specificity across multiple experimental platforms (IHC, flow cytometry, western blotting)

Recent approaches using synthetic antibody fragments (sFabs) have successfully overcome some of these challenges, as demonstrated by the high-resolution structure of a CLDN4-sFab complex determined by cryo-EM . This structural insight provides a framework for developing more effective CLDN4-targeting reagents.

How does CLDN4 interact with other claudin family members to regulate paracellular ion selectivity?

CLDN4 exhibits complex interaction patterns with other claudin family members to regulate paracellular ion selectivity:

This complex interplay between CLDN4 and other claudins creates an intricate regulatory system for paracellular permeability. Since CLDN4 cannot form tight junction strands on its own , its function is inherently dependent on interactions with other claudin family members, highlighting the importance of studying claudins as a functional network rather than isolated proteins.

What structural insights have cryo-EM studies revealed about CLDN4-antibody interactions?

Recent cryo-EM studies have provided valuable structural insights into CLDN4-antibody interactions:

• High-Resolution Structural Analysis:

  • Researchers have determined the high-resolution structure of human claudin-4 in complex with a synthetic antibody fragment (sFab) using cryogenic electron microscopy

  • This structure reveals the precise binding interface between CLDN4 and the antibody fragment

• Binding Mechanism Elucidation:

  • The structural data demonstrates how the sFab achieves selective binding to human CLDN4 over other homologous claudins

  • The binding appears to recognize conformation-dependent epitopes in the second extracellular domain of CLDN4

• Therapeutic Implications:

  • These structural insights provide a framework for designing improved tight junction modulators

  • Understanding the binding interface facilitates rational design of tissue-selective therapies targeting CLDN4

The ability to visualize CLDN4-antibody complexes at high resolution represents a significant advancement in claudin structural biology, as these small membrane proteins have historically been challenging to study due to their physicochemical properties .

How does non-junction CLDN4 participate in cellular signaling pathways distinct from its barrier function?

Beyond its canonical role in tight junctions, CLDN4 participates in non-junction signaling pathways with significant biological consequences:

• Signaling Activities:

  • Non-junction CLDN4 activates integrin beta 1 and Yes-associated protein (YAP) signaling

  • These interactions promote cell proliferation, epithelial-mesenchymal transition (EMT), and stem-like properties

  • CLDN4-mediated signaling may contribute to cancer progression through mechanisms distinct from barrier function

• Functional Evidence:

  • In cholangiocarcinoma cell lines, CLDN4 suppression significantly reduced cell migration and invasion capabilities without affecting proliferation

  • This suggests CLDN4 specifically regulates motility-associated signaling pathways

• Methodological Considerations:

  • Researchers studying CLDN4 should distinguish between junction-associated and non-junction CLDN4 pools

  • Subcellular fractionation techniques can help separate these populations

  • Signaling studies should consider CLDN4's interactions with canonical pathways like integrin and Hippo/YAP signaling

This dual functionality of CLDN4 in both junction formation and signaling may explain some of the seemingly contradictory findings regarding its role in cancer progression, as the relative balance between these functions likely varies across tissue types and disease states.

What epigenetic mechanisms regulate CLDN4 expression in normal and pathological states?

Epigenetic mechanisms play a crucial role in regulating CLDN4 expression across different physiological and pathological contexts:

• DNA Methylation:

  • Hypomethylation of CpG islands in the CLDN4 promoter is associated with upregulation in various cancer types

  • This contrasts with the hypermethylation observed in some contexts, which causes downregulation of CLDN4

  • The methylation status of specific CpG sites likely determines the accessibility of the promoter to transcription factors

• Transcriptional Regulation:

  • The transcription factor Bach1 directly suppresses CLDN4 expression along with E-cadherin to induce EMT

  • This coordinated regulation links CLDN4 expression to broader epithelial differentiation programs

• Methodological Approaches:

  • Bisulfite sequencing to analyze promoter methylation patterns

  • Chromatin immunoprecipitation (ChIP) to identify transcription factor binding

  • CRISPR-based epigenetic editing to experimentally manipulate CLDN4 regulatory elements

Understanding these epigenetic regulatory mechanisms provides potential avenues for therapeutic intervention, as epigenetic modifiers could potentially normalize CLDN4 expression in diseases where it is dysregulated.

What are the most promising future directions for CLDN4 research?

Based on current findings, several promising research directions emerge:

• Therapeutic Development:

  • Further refinement of CLDN4-targeting antibodies and synthetic fragments

  • Combination approaches using CLDN4-targeting agents to enhance conventional chemotherapy penetration

  • Development of small molecule modulators based on structural insights from cryo-EM studies

• Signaling Biology:

  • Deeper investigation of non-junction CLDN4 signaling pathways

  • Resolution of contradictory findings regarding CLDN4's role in EMT and metastasis

  • Exploration of tissue-specific CLDN4 functions that may explain context-dependent effects

• Diagnostic Applications:

  • Validation of CLDN4 as a biomarker for early detection or prognosis in epithelial cancers

  • Development of imaging agents targeting CLDN4 for tumor visualization