Clec12a Antibody

What is CLEC12A and why is it significant in hematological research?

CLEC12A (also known as C-type lectin-like molecule-1, dendritic cell-associated lectin 2, myeloid inhibitory C-type lectin-like receptor, or CLL-1) is a cell surface receptor predominantly expressed on myeloid cells and acute myeloid leukemia (AML) cells. This protein contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) that mediates tyrosine phosphorylation of target MAP kinases and modulates signaling cascades .

The significance of CLEC12A in research stems from several factors:

• Its relatively restricted expression pattern with limited presence on normal hematopoietic stem cells but widespread prevalence on AML blasts and leukemic stem cells

• Its involvement in regulating inflammatory responses through inhibitory signaling pathways

• Its potential as a therapeutic target for AML immunotherapy approaches

• Its role in neutrophil activation and inflammatory disease processes

The protein is composed of 265 amino acid residues with a molecular weight of approximately 30.8 kDa and undergoes post-translational modifications including N-glycosylation .

What are the established protocols for detecting CLEC12A expression by flow cytometry?

Flow cytometry remains the most common application for CLEC12A antibodies in research . Based on validated protocols:

• Cell preparation: Prepare target cells at a concentration of 10^6 cells/100 μL PBS

• Primary antibody incubation: Incubate cells with anti-CLEC12A antibody (typically 1 μg/ml) for 30 minutes at 4°C

• Washing: Centrifuge cells at 1000× g for 1 minute and resuspend in PBS

• Secondary detection: If using unconjugated primary antibodies, incubate with appropriate fluorochrome-conjugated secondary antibody (e.g., anti-mouse PE)

• Analysis: Analyze by flow cytometry using appropriate gating strategies

For determining specific CLEC12A expression, calculate the specific fluorescence intensity (SFI) by dividing median fluorescence values obtained with specific antibody by median fluorescence values obtained with isotype control .

For analyzing leukemic subpopulations, additional markers such as CD34 and CD38 should be incorporated to identify specific cell subsets:

• LSC (CD38-CD34+)

• Progenitors (CD38+CD34+)

• Mature blasts (CD38+CD34-)

How does antibody clone selection affect CLEC12A detection and research outcomes?

Different anti-CLEC12A antibody clones demonstrate varying binding characteristics that can significantly impact experimental results. Research has shown that clones 33C2, 16C6, and 84A2 exhibit different binding profiles when tested against AML cell lines and primary AML patient samples .

When selecting an antibody clone, researchers should consider:

• Binding affinity: Different clones show varying SFI values when tested against the same samples

• Epitope specificity: Certain clones may recognize specific domains of CLEC12A

• Cell type sensitivity: Some clones may perform better with specific AML subtypes

• Experimental application: Certain clones may be optimized for flow cytometry versus Western blotting

A comparative analysis of CLEC12A expression detected by different monoclonal antibodies revealed that clone 33C2 demonstrated superior detection capabilities compared to other clones when tested across a cohort of 22 AML patients . This underscores the importance of clone selection in achieving consistent and sensitive detection of CLEC12A.

How can CLEC12A antibodies be utilized for mechanistic studies of receptor signaling?

CLEC12A antibodies serve as valuable tools for investigating the receptor's signaling mechanisms through several approaches:

• Receptor cross-linking studies: Anti-CLEC12A antibodies can be used to induce receptor clustering, followed by secondary cross-linking antibodies to stimulate signaling events. This approach allows researchers to monitor:

  • ITIM phosphorylation in a Src-dependent manner

  • Recruitment of phosphatases such as SHP-1

  • Subsequent effects on downstream signaling pathways

• Phosphoproteomic analysis: Following CLEC12A cross-linking, phosphoproteomic techniques can identify regulated signaling molecules, including:

  • MAPKs

  • Phosphoinositol kinases

  • Members of the JAK-STAT pathway

• Membrane localization studies: CLEC12A cross-linking induces its translocation to flotillin-rich membrane domains where ITIM phosphorylation occurs, providing insights into spatial regulation of signaling .

• Regulation of activating pathways: CLEC12A-mediated inhibitory signaling can be studied in the context of neutrophil activation by stimuli such as uric acid crystals, which drive hyperphosphorylation of p38 and Akt .

What are the methodological approaches for studying CLEC12A internalization dynamics?

Investigating CLEC12A internalization provides insights into receptor regulation and trafficking. A comprehensive approach includes:

• Quantitative flow cytometry assay:

  • Incubate cells with anti-CLEC12A antibody (3 μg/10^6 cells) for 5 minutes at 37°C

  • Cross-link with secondary antibody (e.g., goat anti-mouse F(ab')2 antibody at 3 μg/10^6 cells) for 5 minutes at 37°C

  • Stop cross-linking on ice and centrifuge at 1000× g for 1 minute

  • Detect remaining surface expression using fluorescently-labeled tertiary antibody

  • Compare to non-cross-linked controls to quantify internalization

• Microscopy-based approaches:

  • Perform confocal microscopy of cells expressing CLEC12A constructs

  • Use fluorescently-labeled antibodies to track receptor localization before and after cross-linking

  • Co-stain with markers of endocytic compartments to determine trafficking routes

• Comparative analysis of wild-type versus mutant receptors:

  • Generate CLEC12A mutants affecting key residues potentially involved in trafficking

  • Compare internalization kinetics between wild-type and mutant forms

  • Assess the impact of mutations on receptor trafficking and signaling

How can researchers effectively use anti-CLEC12A antibodies for in vivo functional studies?

Anti-CLEC12A antibodies can be powerful tools for in vivo functional studies, particularly in disease models. Key methodological considerations include:

• Antibody blockade approach:

  • Administration of blocking antibodies against CLEC12A in animal models of inflammatory disease

  • Monitoring disease progression, cellular infiltration, and inflammatory markers

  • Comparing outcomes with appropriate controls (isotype antibodies)

• Evaluation parameters:

  • Disease progression (e.g., EAE scores in multiple sclerosis models)

  • Tissue pathology (demyelination, inflammation)

  • Myeloid cell infiltration into affected tissues

  • T-cell phenotypes (TH17 responses)

  • Restoration of immune cell distribution in peripheral tissues

In experimental autoimmune encephalomyelitis (EAE) models, CLEC12A antibody blockade has been shown to:

• Delay disease onset

• Attenuate disease severity

• Reduce demyelination and myeloid cell CNS infiltration

• Restore dendritic cell numbers in the spleen

• Decrease the TH17 phenotype within CD4+ T-cells

These findings validate the effectiveness of CLEC12A antibody blocking approaches and provide mechanistic insights into CLEC12A's role in neuroinflammatory conditions.

What are the established protocols for generating CLEC12A mutants for structure-function studies?

Site-directed mutagenesis of CLEC12A provides valuable insights into structure-function relationships. A comprehensive approach includes:

• PCR-based mutagenesis strategy:

  • Design primers incorporating the desired mutation

  • Perform two separate PCR reactions generating fragments upstream and downstream of the mutation site

  • Hybridize the two PCR products and amplify the full-length mutant construct

  • Ligate the product into an appropriate expression vector

• Specific protocol for CLEC12A-HA-C130A mutation:

  • First PCR: Forward primer 5′ CGCCAGTGTGCTGGAATTCTTTACATATT 3′ and reverse primer 5′ GACAAGGCTTAGCTTTGTGCTCTT 3′

  • Second PCR: Use appropriate primers targeting regions flanking the desired mutation

  • Third PCR: Mix and hybridize the two PCR products, then amplify using primers targeting the 5′ and 3′ ends

  • Ligate the product into the pCRII plasmid using the same strategy as for CLEC12A-HA-wt

• Verification and expression:

  • Confirm successful mutagenesis by sequencing

  • Express mutant constructs in appropriate cell lines

  • Verify expression by Western blotting and immunofluorescence

  • Compare surface expression levels with wild-type CLEC12A

How do mutations in the CLEC12A stalk domain affect receptor expression and function?

The stalk domain of CLEC12A contains important cysteine residues that regulate receptor expression and function. Research on CLEC12A mutants has revealed:

• Impact on expression and oligomerization:

  • Mutation of cysteine residues C118 and C130 in the stalk domain affects CLEC12A cell-surface expression

  • Western blot analysis shows altered expression patterns in HeLa cells transiently transfected with C118A, C130A, and C118A/C130A double mutants compared to wild-type

  • Densitometry analysis quantifies the differences in expression levels between wild-type and mutant forms

• Subcellular localization:

  • Confocal microscopy of HeLa cells expressing wild-type versus mutant constructs reveals differences in cellular distribution

  • Permeabilized cells stained with anti-HA antibody and phalloidin demonstrate altered localization patterns for stalk domain mutants

• Functional consequences:

  • Alterations in receptor oligomerization may affect CLEC12A's ability to recruit signaling molecules

  • Changes in surface expression level impact the receptor's availability for ligand binding

  • Mutation of key cysteine residues may disrupt disulfide bond formation essential for proper receptor folding and stability

What approaches are being explored for CLEC12A-targeted immunotherapy in AML?

CLEC12A is emerging as a promising target for AML immunotherapy due to its restricted expression pattern. Several approaches under investigation include:

• Bispecific antibodies targeting CLEC12A:

  • Redirect T cells or NK cells to CLEC12A-expressing AML cells

  • Several clinical trials evaluating safety and efficacy (e.g., NCT03038230)

  • Demonstrate manageable toxicity and signs of efficacy in early clinical testing

• Antibody-drug conjugates (ADCs):

  • Conjugate cytotoxic payloads to anti-CLEC12A antibodies for targeted delivery

  • Preclinical studies demonstrate efficacy in eliminating AML cells

  • Clinical evaluation ongoing

• CLEC12A-targeted CAR-T cells:

  • Engineering T cells to express chimeric antigen receptors targeting CLEC12A

  • Multiple clinical trials underway (NCT04219163, NCT06128044, NCT06017258)

  • Promising approach for targeting AML stem cells

• Immunocytokines with conditional activity:

  • Development of CLEC12A-directed immunocytokines with IL-15 activity (MIC12)

  • Designed with NK cell-focused activity and reduced systemic cytokine effects

  • Incorporate IL-15 E46K mutein with abrogated binding to IL-15Rα for conditional activity

The primary advantage of CLEC12A as a therapeutic target is its limited expression on normal hematopoietic stem cells and other healthy tissues coupled with widespread prevalence on AML blasts and leukemic stem cells .

What technical considerations are important when developing CLEC12A-targeting immunocytokines?

Development of CLEC12A-directed immunocytokines requires careful consideration of multiple factors:

• Construct design and production:

  • Composition typically includes humanized variable domains of anti-CLEC12A antibody, Fc domain (often with modifications), and cytokine moiety

  • Specific example: MIC12 construct composed of humanized VH and VL domains of 33C2 antibody, Fc domain of human IgG1 with SDIE modification, and human IL-15 E46K mutein

  • Production quality assessed by SDS-PAGE and size exclusion chromatography to evaluate purity and aggregate content

• Functional validation:

  • Target binding: Confirm that humanization and immunocytokine construction do not affect binding to CLEC12A-expressing cells

  • Cytokine receptor interaction: Validate binding properties to cytokine receptors (e.g., IL-15 receptors)

  • Conditional activity: Verify that cytokine activity is restricted to target antigen binding

• Comparative analysis:

  • Compare with Fc-optimized antibodies without cytokine moiety

  • Evaluate efficacy against AML cells in vitro and in vivo

  • Assess potential for reduced systemic cytokine effects

For example, a MIC12 construct containing IL-15 E46K mutein exhibited weak interaction with IL-15Rα-expressing cells compared to an IL-15 wild-type control construct while retaining binding to IL15Rβ/γ-expressing cells, demonstrating the desired conditional activity profile .

How should researchers analyze variability in CLEC12A expression across different AML patient samples?

Analysis of CLEC12A expression across patient samples requires robust methodological approaches:

• Standardized quantification methods:

  • Calculate specific fluorescence intensity (SFI) by dividing median fluorescence values obtained with specific antibody by values obtained with isotype control

  • Report both SFI values and percentage of positive cells

  • Use box plots showing first to third quartiles with whiskers indicating min-max values for population data

• Statistical analysis approaches:

  • For comparing detection by different antibody clones: Friedman test with Dunn's multiple comparison test

  • For comparing expression across different cell subpopulations: appropriate paired statistical tests

  • Document p-values to indicate statistical significance of differences

• Subpopulation analysis:

  • Implement consistent gating strategies for identifying leukemic subpopulations

  • Compare CLEC12A expression across different subsets:

    • Leukemic stem cells (LSC, CD34+CD38-)

    • Progenitor cells (CD34+CD38+)

    • Mature blasts (CD34-CD38+)

Table 1: Expression of CLEC12A Across Leukemic Subpopulations

Research has shown that while all subpopulations display substantial CLEC12A positivity (SFI>5), the LSC population typically exhibits lower SFI values and fewer positive cells compared to progenitor cells and mature blasts .

What factors should researchers consider when interpreting results from CLEC12A knock-out versus antibody blocking studies?

When comparing results from genetic versus antibody-based approaches:

Researchers should ideally employ both approaches when possible, as the convergence of results from complementary methods provides the strongest evidence for CLEC12A's biological functions.