Col4a2 Antibody

What is COL4A2 and why is it an important research target?

COL4A2 (Collagen Type IV, alpha 2) is one of the six alpha chains that form type IV collagen, a major structural component of basement membranes. It forms a heterotrimeric structure with COL4A1, creating a "chicken-wire" meshwork together with laminins, proteoglycans, and entactin/nidogen . Through this structural role, COL4A2 contributes to tissue integrity and barrier function.

Additionally, canstatin, a cleavage product corresponding to the COL4A2 NC1 domain, possesses both anti-angiogenic and anti-tumor cell activity. It inhibits endothelial cell proliferation and migration, reduces mitochondrial membrane potential, and induces apoptosis—specifically Fas-dependent apoptosis through activation of procaspase-8 and -9 . COL4A2 also serves as a ligand for alphavbeta3 and alphavbeta5 integrins .

COL4A2 mutations are associated with a broad spectrum of disorders including myopathy, glaucoma, and hemorrhagic stroke, making it an important target for biomedical research .

When selecting a COL4A2 antibody, researchers should consider the specific region (epitope) of the protein targeted by the antibody based on their research objectives:

• N-Terminal Antibodies: Several commercially available antibodies target the N-terminal region of COL4A2 . These antibodies are useful for detecting the full-length protein and studying the protein's structural role in basement membranes.

• C-Terminal Antibodies: Antibodies targeting the C-terminal NC1 domain can be particularly valuable for studying canstatin, the cleavage product with anti-angiogenic and anti-tumor properties .

• Specific Amino Acid Region Antibodies: Some antibodies target specific amino acid sequences, such as:

  • AA 151-200 region

  • AA 1486-1712 region

  • AA 1697-1712 (C-Term) region

The choice of epitope should be guided by:

• The research question (e.g., studying full-length protein vs. cleaved fragments)

• Potential post-translational modifications that might mask certain epitopes

• Protein conformation in the experimental conditions

• Sequence conservation if studying COL4A2 across different species

For cross-species studies, researchers should verify sequence homology in the target epitope region between humans and the model organism of interest .

What are the optimal storage conditions for COL4A2 antibodies?

Proper storage is critical for maintaining antibody functionality. Based on manufacturer recommendations:

Most COL4A2 antibodies should be stored at -20°C and are stable for one year after shipment under these conditions . The standard storage buffer typically consists of PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 .

For small volume antibodies (e.g., 20μl sizes), some preparations contain 0.1% BSA as a stabilizer . Importantly, aliquoting is generally unnecessary for -20°C storage, which simplifies laboratory handling procedures .

When working with the antibody:

• Avoid repeated freeze-thaw cycles

• Return to -20°C promptly after use

• Allow the antibody to reach room temperature before opening the vial

Following these guidelines will help maintain antibody specificity and sensitivity over time.

How can researchers validate COL4A2 antibody specificity in knockout/knockdown studies?

Validating antibody specificity using genetic manipulation approaches is a gold standard method, particularly important for COL4A2 where protein size and potential cross-reactivity with other collagen chains can complicate interpretation. A methodological approach includes:

• CRISPR-Based Knockout Validation:
  Researchers have successfully employed CRISPR/Cas9 systems targeting COL4A2 using guide RNA sequences such as:

  • CCTGGAGACGCCGGCTTACC (COL4A2_1)

  • GAAAGTCGCTTACCGCCGTA (COL4A2_2)

  These have been delivered via lentiviral vectors (e.g., lentiCRISPRv2) with successful knockout validation in cell lines such as C91-PL .

• Expression Analysis in Knockouts:
  When validating knockouts, researchers should examine:

  • Protein levels by Western blot

  • mRNA expression by qPCR

  • Immunostaining patterns in intact cells/tissues

• Controls for Validation:

  • Include non-targeting scramble guide RNA controls (e.g., GCACTACCAGAGCTAACTCA)

  • Compare results with parental cell lines

  • Consider multiple guide RNA combinations to reduce off-target effects

An important consideration is that even low mRNA expression levels (as low as 1×10^-3 relative to controls) can produce robust COL4A2 protein expression, indicating high protein stability . This means complete elimination of protein may require extended time after genetic knockout.

What are the considerations for detecting COL4A2 in basement membrane studies?

When investigating COL4A2 in basement membranes, researchers should consider several methodological aspects:

• Sample Preparation for Ultrastructural Analysis:
  While light microscopy may show normal appearance, electron microscopy often reveals significant ultrastructural abnormalities in COL4A2-related disorders. These include focal interruptions, expansions, thickening, or fragmentation of basement membranes . Proper fixation and processing for electron microscopy are essential.

• Antibody Selection for Basement Membrane Studies:

  • Use antibodies validated in tissues with prominent basement membranes (kidney, blood vessels)

  • Consider antibodies specifically validated for immunohistochemistry on paraffin sections, such as those tested on human kidney tissue

  • Recommended dilutions for IHC applications range from 1:1000 to 1:4000

• Antigen Retrieval Optimization:
  For successful immunostaining of basement membranes in fixed tissues:

  • Primary recommendation: TE buffer pH 9.0

  • Alternative method: Citrate buffer pH 6.0

• Co-localization Studies:
  Combining COL4A2 staining with other basement membrane markers provides more comprehensive analysis:

  • Laminins

  • Nidogen/entactin

  • Perlecan

  • COL4A1 (binding partner)

For tissues with subtle basement membrane abnormalities, immunofluorescence with high-resolution imaging techniques (super-resolution microscopy, confocal microscopy) may reveal defects not visible by conventional light microscopy.

How does COL4A2 contribute to viral biofilm formation and how can this be studied?

Recent research has revealed a unique role for COL4A2 in viral biofilm (VB) formation, particularly in HTLV-1 infection. This represents an emerging area for antibody-based investigations:

• COL4A2 Upregulation in Viral Infection:
  Among collagens present in viral biofilms, COL4 (specifically COL4A1 and COL4A2) is uniquely upregulated in HTLV-1 infection. This upregulation appears to be specific to HTLV-1 oncogenesis rather than a general feature of cellular transformation . Various HTLV-1 positive T-cell lines (MT-2, C91-PL, HuT-102) show detectable amounts of COL4A1 and COL4A2, while HTLV-1 negative T-cell lines (Jurkat) and other tumor-derived B-cell lines (including those from Burkitt lymphoma, Primary Effusion lymphoma, and Hodgkin lymphoma) lack COL4 expression .

• Methodological Approaches to Study COL4A2 in Viral Biofilms:

  • Confocal Microscopy: Compare permeabilized and non-permeabilized infected cells to discriminate between extra- and intracellular portions of COL4 protein

  • Co-staining Protocols: Combine COL4A2 antibodies (dilution dependent on application) with plasma membrane markers (e.g., CD98) and DNA tracers (DAPI)

  • Expression Analysis: Quantify COL4A2 mRNA levels in patient samples using qPCR to correlate with disease progression

• Disease Correlation Data:
  Research on HAM/TSP (HTLV-1-Associated Myelopathy/Tropical Spastic Paraparesis) patients has shown that slowly progressing HAM/TSP patients exhibit statistically significant elevated transcript levels of COL4A2 compared to non-infected donors, asymptomatic carriers, and rapidly progressing patients . This suggests potential biomarker applications for COL4A2 in monitoring disease progression.

What methodological approaches can overcome challenges in detecting COL4A2 in different experimental systems?

COL4A2 detection presents several technical challenges that researchers can address through optimized methodological approaches:

• Molecular Weight Considerations:

  • Calculated molecular weight: 168 kDa

  • Observed molecular weight: 200 kDa

  This discrepancy is likely due to post-translational modifications and should be considered when interpreting Western blot results.

• Application-Specific Optimization:

  Application	Technical Challenge	Optimization Strategy
  Western Blot	High molecular weight makes transfer difficult	Extended transfer times (50-90 minutes at 150mA); use nitrocellulose membranes
  IHC	Variable antigen accessibility in fixed tissues	Test both TE buffer pH 9.0 and citrate buffer pH 6.0 for antigen retrieval
  IF	Background staining	Extended blocking (≥1.5 hours); use 5% non-fat milk/TBS

• Tissue-Specific Detection Strategies:
  For tissues with known COL4A2 expression:

  • Human kidney tissue is recommended for validating antibody performance in IF-P and IHC

  • Lung tissue (mouse, rat) and HeLa cells are suitable for WB validation

  • Human breast hyperplasia and breast cancer tissues show positive IHC staining

  • Blood vessels in rat cerebrum show strong positive staining

• Knockdown Verification:
  Given the high stability of COL4A2 protein, even low mRNA expression levels (as low as 1×10^-3) can produce robust protein expression. This requires extended time periods after genetic knockdown to observe protein reduction .

How can COL4A2 antibodies be used to investigate disease-associated mutations?

COL4A2 mutations contribute to a broad spectrum of disorders including myopathy, glaucoma, and hemorrhagic stroke. Antibody-based approaches can help elucidate mutation effects:

• Detection of Mutant Protein Localization:

  • Immunofluorescence can reveal altered subcellular distribution of mutant COL4A2

  • Compare staining patterns between wild-type and mutant samples

  • Co-staining with organelle markers (ER, Golgi) can identify trafficking defects

• Quantification of Secreted vs. Intracellular Protein:
  Compare permeabilized vs. non-permeabilized cell staining to assess:

  • Retention of mutant protein within cells

  • Reduced secretion into extracellular matrix

  • Altered incorporation into basement membranes

• Analysis of Patient Biopsies:
  In patients with COL4A2 mutations, tissue biopsies often appear normal by light microscopy but show significant ultrastructural abnormalities by electron microscopy . Immunostaining with COL4A2 antibodies can reveal:

  • Focal interruptions in basement membranes

  • Expanded and thickened capillary basement membranes

  • Fragmented basement membranes

• Brain Imaging Correlation:
  Even in the absence of overt porencephaly or hemorrhagic stroke, individuals with COL4A2 mutations may have clinically silent defects such as:

  • Diffuse or periventricular leukoencephalopathy

  • Calcification

  • Intracranial aneurysms

  • Cerebral microbleeds

  Correlating immunohistochemical findings with these imaging abnormalities can provide insights into pathogenesis.