CPNE6 Antibody

What is CPNE6 and why is it important in neuroscience research?

CPNE6 (Copine VI) is a brain-specific member of the copine family, which consists of calcium-dependent membrane-binding proteins. It contains two N-terminal C2 domains and one von Willebrand factor A domain . CPNE6 is primarily expressed in excitatory neurons of the hippocampus and plays a critical role in synaptic plasticity .

Research significance:

• CPNE6 translates initial calcium signals into changes in spine structure during long-term potentiation (LTP)

• It is recruited from the cytosol of dendrites to postsynaptic spine membranes by calcium transients that precede LTP

• Temporal expression studies show that CPNE6 levels increase during the period of synapse formation and consolidation

This protein is of particular interest because it provides insights into calcium-dependent mechanisms of learning and memory at the molecular level.

What is the expression pattern of CPNE6 in the brain and during development?

CPNE6 shows a distinctive spatiotemporal expression pattern:

Spatial expression:

• Strongly expressed in the dentate gyrus and CA regions of the hippocampus

• Some expression in the cerebral cortex and amygdala

• Expression is confined to excitatory neurons (CaMKII-positive cells), not in inhibitory neurons (GAD67-negative) or glial cells (GFAP-negative)

Temporal expression pattern:

• Not detected at birth

• Expression levels increase between postnatal day 7 (P7) and P28, then remain high

• In primary hippocampal neuron cultures, CPNE6 mRNA shows steep increases at DIV12 and DIV14, coinciding with synapse formation and consolidation

This expression pattern suggests that CPNE6 functions in mature excitatory neurons rather than during early development, particularly in regions associated with learning and memory.

How do I select the appropriate CPNE6 antibody for my specific application?

Selection of CPNE6 antibodies should be based on the following criteria:

Application compatibility:

Target region specificity:

• N-terminal targeting antibodies (e.g., ABIN1539048, AA 138-166)

• C-terminal targeting antibodies

• Middle region targeting antibodies

• Full-length protein antibodies

Host species considerations:
Most CPNE6 antibodies are rabbit polyclonal, making them suitable for co-staining with mouse monoclonal antibodies against other targets .

Species reactivity:
Ensure the antibody recognizes CPNE6 in your species of interest. Most antibodies react with human, mouse, and rat CPNE6 .

For critical experiments, validate antibody specificity using appropriate controls, such as CPNE6 knockout tissue or CPNE6 knockdown cells, to confirm specificity .

What are the most effective validation strategies for CPNE6 antibodies?

Comprehensive validation of CPNE6 antibodies should include:

Genetic validation:

• Using tissue/cells from CPNE6 knockout mice as negative controls

• Using CPNE6 knockdown approaches with shRNA constructs targeting CPNE6 (e.g., clone ID 5: CCCCTTCATGGAGATCTATAAGA, clone ID 7: TACATACCTTCCTGGATTATATC)

• Testing with rescue constructs containing silent mutations to restore CPNE6 expression

Expression pattern validation:

• Confirming that staining matches known expression patterns (primarily in excitatory neurons of hippocampus)

• Verifying molecular weight in Western blots (calculated: 62 kDa; observed: ~65 kDa)

• Checking subcellular localization (cytosolic in basal conditions, membrane-associated upon calcium elevation)

Cross-reactivity assessment:

• Testing against related copine family members (CPNE1, CPNE2, CPNE3, CPNE7)

• Using antibodies absorbed against related copines (e.g., antibodies absorbed against copine-2)

Calcium-dependent functionality:

• Validating that CPNE6 antibodies can detect the calcium-dependent membrane translocation of CPNE6 (cytosolic in EDTA conditions, membrane-associated in calcium)

The most rigorous approach combines multiple validation methods to ensure antibody specificity and functionality.

What are the optimal protocols for using CPNE6 antibodies in Western blotting?

Sample preparation:

• Brain tissue samples should be homogenized in 320 mM sucrose, 4 mM HEPES-KOH, pH 7.4 with protease inhibitors

• For subcellular fractionation, separate cytosolic and membrane fractions in the presence of either calcium or EDTA to demonstrate calcium-dependent membrane association

Western blotting protocol:

• Load 20-30 μg of protein per lane

• Use 10-12% SDS-PAGE gels for optimal separation

• Transfer to PVDF or nitrocellulose membranes

• Block with 5% non-fat milk in TBST

• Dilute primary CPNE6 antibodies according to manufacturer recommendations:

  • 13782-1-AP: 1:2000-1:12000

  • DF12913: Application-dependent

  • Other antibodies: 1:500-1:5000

• Incubate overnight at 4°C

• Wash with TBST

• Incubate with HRP-conjugated secondary antibodies

• Develop using ECL or other detection systems

Expected results:

• CPNE6 should be detected at approximately 62-65 kDa

• Strong signals in brain lysates, particularly hippocampus

• Weak or no signal in non-neuronal tissues

• In calcium-dependent fractionation experiments, CPNE6 should co-purify with PSD95 in the presence of calcium but remain cytosolic in EDTA conditions

How can I optimize CPNE6 antibody performance in immunohistochemistry of brain tissue?

Tissue preparation:

• Perfusion fixation with 4% paraformaldehyde is recommended

• Post-fix tissue for 2-4 hours at 4°C

• Cryoprotect in 30% sucrose before freezing and sectioning

Antigen retrieval options:

• Primary recommendation: TE buffer pH 9.0

• Alternative: Citrate buffer pH 6.0

Staining protocol:

• Block sections with 5-10% normal serum corresponding to secondary antibody host

• Add Fc receptor blocking antibody to reduce non-specific binding

• Dilute primary CPNE6 antibody:

  • 13782-1-AP: 1:250-1:1000

  • Other antibodies: Follow manufacturer's recommendations

• Incubate overnight at 4°C

• Wash thoroughly with PBS

• Apply fluorescently-tagged secondary antibodies

• Counterstain with nuclear dye if desired

• Mount with anti-fade mounting medium

Controls and considerations:

• Include a no-primary-antibody control

• Use CPNE6 knockout tissue as a negative control when available

• For co-localization studies, combine CPNE6 antibody with markers for excitatory neurons (CaMKII), inhibitory neurons (GAD67), or glial cells (GFAP)

• Expected staining pattern: Strong in dentate gyrus and CA regions, primarily in the neuropil

How can I use CPNE6 antibodies to study calcium-dependent membrane translocation?

CPNE6 undergoes calcium-dependent translocation from the cytosol to membranes, making it a useful tool for studying calcium signaling in neurons. Here are methodological approaches:

Biochemical fractionation approach:

• Prepare neuronal or brain samples in buffers containing either calcium (1-5 μM) or EDTA/EGTA

• Separate cytosolic and membrane fractions by differential centrifugation

• Analyze CPNE6 distribution by Western blotting

• Compare with PSD95 as a membrane/PSD marker

Live imaging approach:

• Transfect neurons with Copine-6-GFP expression constructs

• Perform baseline imaging to observe cytosolic distribution

• Apply stimuli that elevate intracellular calcium:

  • Glutamate receptor agonists

  • Calcium ionophores (ionomycin)

  • Electrical stimulation protocols that induce LTP

• Monitor translocation of Copine-6-GFP to dendritic spines

• Quantify fluorescence intensity changes in spines versus dendrite shafts

Calcium concentration dependence:

• Half-maximal binding of Copine-6 to membranes occurs between 1-5 μM calcium

• Complete dissociation occurs with calcium chelation by EGTA

This approach can provide insights into how specific patterns of neuronal activity and calcium signaling regulate CPNE6 localization and function in synaptic plasticity.

What experimental designs are most effective for investigating CPNE6's role in synaptic plasticity?

Genetic manipulation approaches:

• Knockdown/knockout studies:

  • Use shRNA constructs targeted against CPNE6 (e.g., clone ID 5: CCCCTTCATGGAGATCTATAAGA)

  • Use CPNE6 knockout mice (e.g., lacZ knock-in mice)

  • Include rescue experiments with CPNE6 constructs containing silent mutations

• Viral vector delivery:

  • AAV-mediated delivery of CPNE6 shRNA (e.g., Cpne6 AAV siRNA Pooled virus Serotype 6)

  • Stereotaxic injection coordinates for hippocampus: from Bregma: AP: −1.75; ML: +/− 1.0; DV: −1.5 mm

Functional assays:

• Electrophysiology:

  • Field recordings to assess LTP in CPNE6-manipulated animals

  • Patch-clamp recordings to evaluate synaptic transmission

• Morphological analysis:

  • Dendritic spine imaging using combined immunofluorescence for CPNE6 and cytoskeletal markers

  • LifeAct-RFP co-expression to visualize actin dynamics in relation to CPNE6

• Molecular interaction studies:

  • Co-immunoprecipitation of CPNE6 with synaptic proteins

  • Example protocol: Use antibody-coupled Protein A/G Dynabeads, incubate with lysates for 2 hours at 4°C

Activity-dependent regulation:

• BDNF stimulation:

  • Treat hippocampal neurons with BDNF

  • Quantify changes in CPNE6 expression and localization

  • Use TrkB-Fc as a control to sequester BDNF

• Co-localization with synaptic markers:

  • Combine CPNE6 antibodies with antibodies against:

    • Presynaptic markers (e.g., synaptophysin, synaptobrevin)

    • Postsynaptic markers (e.g., PSD95, Homer)

    • Glutamate receptors (e.g., GluA1, GluA2, GluN1)

These experimental approaches allow comprehensive investigation of CPNE6's role in different aspects of synaptic plasticity, from molecular interactions to functional outcomes.

How can I minimize background and optimize signal-to-noise ratio when using CPNE6 antibodies?

Common challenges with CPNE6 antibodies include:

• Non-specific binding

• High background in neural tissue

• Variable signal intensity

Optimization strategies:

• Blocking optimization:

  • Include Fc receptor blocking antibody before adding primary antibodies

  • Test different blocking agents (BSA, normal serum, commercial blockers)

  • Extend blocking time to 1-2 hours at room temperature

• Antibody dilution optimization:

  • Perform titration experiments to determine optimal concentration

  • For Western blot: Test range from 1:2000 to 1:12000

  • For IHC: Test range from 1:250 to 1:1000

• Sample preparation improvements:

  • For tissue sections: Optimize fixation time and conditions

  • For Western blotting: Include phosphatase inhibitors in addition to protease inhibitors

  • Use freshly prepared samples when possible

• Washing protocols:

  • Increase number of washes (minimum 3 washes of 10 minutes each)

  • Use 0.1-0.3% Triton X-100 in wash buffer for immunostaining

  • For Western blots, use 0.1% Tween-20 in TBS

• Detection system selection:

  • For low abundance detection, use signal amplification methods

  • For fluorescence, select secondary antibodies with minimal spectral overlap

  • Use highly cross-adsorbed secondary antibodies to minimize cross-reactivity

How should I design controls for experiments using CPNE6 antibodies?

Essential controls for CPNE6 antibody experiments:

• Negative controls:

  • Omission of primary antibody while maintaining all other steps

  • Use of non-immune IgG from the same species as the primary antibody

  • Ideally, use CPNE6 knockout or knockdown samples:

    • Tissue from CPNE6 knockout mice

    • Cells transfected with CPNE6 shRNA (e.g., clone ID 5: CCCCTTCATGGAGATCTATAAGA)

  • Scrambled shRNA construct (e.g., GGAATCTCATTCGATGCATAC) as control for knockdown experiments

• Specificity controls:

  • Antibody pre-adsorption with immunizing peptide

  • Testing in tissues known to be negative for CPNE6 (e.g., non-neuronal tissues)

  • Using multiple antibodies against different epitopes of CPNE6

• Functional validation controls:

  • Calcium-dependent translocation assays (cytosolic in EDTA, membrane-associated with calcium)

  • Rescue experiments with CPNE6 constructs containing silent mutations

• Quantification controls:

  • Include loading controls for Western blots (e.g., α-tubulin, GAPDH)

  • Use standardized acquisition settings for all samples in imaging experiments

  • Include reference standards of known concentration when quantifying protein levels

Proper implementation of these controls ensures the reliability and reproducibility of results obtained with CPNE6 antibodies.

How can CPNE6 antibodies be used to investigate neurological disorders?

CPNE6 has been implicated in various neurological conditions, including epilepsy . Here are methodological approaches for using CPNE6 antibodies in disease research:

Comparative expression analysis:

• Collect tissue samples from disease models and appropriate controls

• Perform Western blot analysis using standardized CPNE6 antibody protocols

• Quantify expression differences normalized to loading controls

• Correlate expression changes with disease parameters

Example from epilepsy research:

• Increased CPNE6 expression has been documented in patients with refractory epilepsy and in rat models of epilepsy

• Methods involved Western blotting with CPNE6-specific antibodies

Immunohistochemical characterization:

• Prepare tissue sections from disease models and controls

• Use optimized IHC protocols with CPNE6 antibodies

• Analyze changes in:

  • Regional expression patterns

  • Cellular distribution

  • Co-localization with disease markers

Functional studies:

• Investigate calcium-dependent translocation of CPNE6 in disease models

• Examine CPNE6 interactions with other proteins using co-immunoprecipitation

• Correlate CPNE6 dysfunction with cellular phenotypes relevant to the disease

These approaches can provide insights into how CPNE6 dysregulation contributes to neurological disorders and potentially identify new therapeutic targets.