CSTF2T Antibody

What is CSTF2T and what is its primary biological function?

CSTF2T (Cleavage stimulation factor subunit 2 tau variant) plays a significant role in AAUAAA-independent mRNA polyadenylation, particularly in germ cells. It is directly involved in the binding to pre-mRNAs and functions as part of the cellular machinery responsible for RNA processing. The protein is also known by several other names including TauCstF-64, CF-1 64 kDa subunit tau variant, and Cleavage stimulation factor 64 kDa subunit tau variant . Unlike its paralog CSTF2 (which is widely expressed), CSTF2T shows a more restricted expression pattern, primarily in testis among normal tissues .

What are the validated applications for CSTF2T antibodies?

CSTF2T antibodies have been successfully employed in multiple experimental techniques:

• Western blotting (WB): Typically used at 1/1000 dilution

• Immunohistochemistry on paraffin-embedded sections (IHC-P): Effective at 1/250 dilution

• Immunocytochemistry/Immunofluorescence (ICC/IF)

These applications have been validated with human cell lines including Jurkat, PC3, and HeLa, consistently detecting the predicted 64 kDa band in Western blot analyses . For optimal IHC-P results, heat-mediated antigen retrieval with citrate buffer (pH 6) is recommended before proceeding with the staining protocol .

How can researchers validate CSTF2T antibody specificity?

Proper validation of CSTF2T antibody specificity requires a multi-faceted approach:

• Positive controls: Use cell lines known to express CSTF2T (e.g., Jurkat, PC3, HeLa)

• Negative controls: Include CSTF2T knockout models (Cstf2t-/- mice or tissues)

• Antibody dilution optimization: Test a range of dilutions to determine optimal signal-to-noise ratio

• Comparative antibody testing: Compare results with different antibody clones targeting distinct epitopes (e.g., monoclonal 6A9 vs. polyclonal Bethyl A301-487A)

• Western blot analysis: Confirm detection of appropriately sized band (64 kDa)

Cross-reactivity with the paralog CSTF2 is a potential concern, necessitating careful validation in experimental systems .

What sample preparation protocols are recommended for CSTF2T detection?

For optimal CSTF2T detection across different applications:

Western blot preparation:

• Lyse tissues/cells in extraction buffer (DPBS, 0.5% Triton X-100, 2 mM PMSF, 0.02% NaN₃)

• Brief sonication followed by 10-minute incubation on ice

• Centrifugation at 400×g for 10 minutes at 4°C

• Load equal protein amounts (typically 10 μg) on gradient gels (4-12% Bis-Tris recommended)

IHC-P preparation:

• Fix tissues with 4% paraformaldehyde

• Embed in paraffin and section at 5 μm thickness

• Perform heat-mediated antigen retrieval with citrate buffer pH 6

• Block with 10% normal serum

• Incubate with primary antibody (1:200-1:250) overnight at 4°C

What is the prognostic significance of CSTF2T expression in cancer?

Multiple studies have established correlations between CSTF2T expression and cancer prognosis:

• In non-small cell lung cancer: Immunohistochemical analysis of 327 lung cancer samples demonstrated that strong CSTF2T expression significantly correlates with poor patient prognosis (P = 0.0079). Multivariate analysis further confirmed CSTF2T positivity as an independent prognostic factor .

• In hepatocellular carcinoma (HCC): CSTF2T expression is associated with enhanced glycolysis and poorer outcomes. Analysis of multiple HCC databases (TCGA, GEO, ICGC) has established CSTF2T as a potential prognostic biomarker for HCC patients .

These findings suggest that CSTF2T expression analysis in tumor biopsies could inform clinical decision-making regarding adjuvant therapy and patient follow-up protocols .

What experimental approaches can effectively assess CSTF2T's functional role in carcinogenesis?

To investigate CSTF2T's role in cancer development and progression, researchers have employed several complementary approaches:

In vitro methodologies:

• siRNA-mediated knockdown: Suppression of CSTF2T expression inhibits lung cancer cell growth

• CRISPR-Cas9 gene editing: Using sgRNAs targeting CSTF2T (e.g., sgRNA-F: CACCGACAGGAAAGCCAAAGGTTA, sgRNA-R: AAACTAACCCTTTGGCTTTCCTGTC)

• Overexpression studies: Exogenous expression of CSTF2T promotes growth and invasion of mammalian cells

• Cell-based functional assays: Proliferation, invasion, and metabolic analysis of cells with modified CSTF2T expression

In vivo approaches:

• Subcutaneous xenograft models: Implantation of CSTF2T-modulated cancer cells in immunocompromised mice

• CRISPR-Cas9 gene editing in mice: Using liver-specific delivery methods

• Hydrodynamic tail vein injection: Delivery of plasmid mixtures containing CSTF2T-targeting constructs

These methodologies have demonstrated that CSTF2T plays important roles in cellular proliferation, invasion, and metabolic regulation, particularly glycolysis in cancer cells .

How should researchers design CRISPR-Cas9 experiments to effectively target CSTF2T?

Successful CRISPR-Cas9 targeting of CSTF2T requires careful experimental design:

sgRNA design considerations:

• Target sequences with high specificity to avoid off-target effects

• For human CSTF2T: sgRNA-F: CACCGACAGGAAAGCCAAAGGTTA, sgRNA-R: AAACTAACCCTTTGGCTTTCCTGTC

• For mouse studies: Two complementary sgRNAs can improve knockout efficiency:

  • sgRNA-F1: CACCGCAGCGGGAGAGCACTTCGAG, sgRNA-R1: AAACTGCGGAACTTGAATGGGCGT

  • sgRNA-F2: ACGCCCATTCAAGTTCCGCA, sgRNA-R2: CTCGAAGTGCTCTCCCGCTGC

Vector system selection:

• Lentiviral delivery: Lenti-CRISPR-V2 vector (Addgene #52,961)

• Packaging plasmids: psPAX2 (Addgene #12,260) and envelope plasmid pMD2.G (Addgene #12,259)

• For stable cell lines: Include puromycin selection marker (typically 5 μg/ml)

Validation protocols:

• Western blot analysis using validated antibodies

• Functional assays to confirm phenotypic changes

• Sequencing of targeted locus to confirm genomic alterations

For in vivo applications, hydrodynamic tail vein injection has proven effective for liver-specific targeting in mouse models .

What pathways and biological processes are regulated by CSTF2T in cancer cells?

Gene expression and pathway analyses have identified several biological processes associated with CSTF2T function in cancer:

• Cellular energy metabolism: CSTF2T is associated with enhanced glycolysis in cancer cells, potentially contributing to the Warburg effect

• Cell proliferation and growth: CSTF2T expression promotes cancer cell growth through mechanisms that may involve alternative RNA processing of cell cycle regulators

• Cellular invasion: Exogenous CSTF2T expression enhances invasive properties of cells, suggesting a role in metastatic processes

Bioinformatic analyses of CSTF2T-correlated genes (using Spearman correlation with coefficients ≥0.5) followed by Gene Ontology (GO) and KEGG pathway analyses have identified specific molecular pathways modulated by this protein. Gene Set Enrichment Analysis (GSEA) comparing high and low CSTF2T-expressing tumors further elucidates the biological processes affected by this RNA processing factor .

How can researchers investigate CSTF2T's role in alternative polyadenylation?

CSTF2T's primary function involves mRNA 3' end processing, particularly in AAUAAA-independent polyadenylation. To study this specialized function:

• RNA-Seq analysis focusing on 3' UTR usage and polyadenylation site selection

• CLIP-Seq (Cross-linking immunoprecipitation) to identify direct CSTF2T binding sites

• Reporter assays with constructs containing alternative polyadenylation signals

• Comparison between wild-type and CSTF2T-depleted cells to identify differentially processed transcripts

• Analysis of poly(A) tail length and stability in CSTF2T-manipulated experimental systems

These approaches can help elucidate how CSTF2T affects the transcriptome through alternative polyadenylation, potentially contributing to cancer-specific gene expression patterns .

What are the therapeutic implications of targeting CSTF2T in cancer?

CSTF2T represents a promising therapeutic target for cancer treatment for several reasons:

• Cancer-specific expression: Limited expression in normal tissues but upregulation in various cancers suggests a favorable therapeutic window

• Correlation with aggressive disease: Association with poor prognosis indicates functional importance in disease progression

• Functional significance: CSTF2T knockdown inhibits cancer cell growth in experimental models

• Metabolic regulation: Association with glycolysis suggests CSTF2T inhibition might disrupt cancer metabolism

Potential therapeutic strategies include:

• RNAi-based approaches targeting CSTF2T mRNA

• Small molecule inhibitors disrupting CSTF2T protein function

• CRISPR-based therapeutic strategies

The development of CSTF2T-targeting therapeutics could provide novel treatment options for patients with CSTF2T-positive tumors, particularly those with aggressive disease features and poor prognosis .

What animal models are most appropriate for studying CSTF2T function?

Several animal models have proven effective for CSTF2T research:

• Cstf2t knockout mice: Valuable for studying developmental and physiological roles of CSTF2T, particularly in reproductive biology

• Xenograft models: BALB/c nude mice implanted with CSTF2T-modified human cancer cells (e.g., Huh7 cells) to study tumor growth and invasion

• CRISPR-engineered mouse models: C57BL/6 mice with CSTF2T-targeted CRISPR constructs delivered via hydrodynamic tail vein injection to study liver-specific effects

• Hydrodynamic transfection models: Tail vein injection of plasmid mixtures containing CSTF2T-targeting constructs along with oncogenic drivers (e.g., MYC) and transposase for stable integration

These models enable investigation of CSTF2T's role in both normal development and pathological conditions, providing valuable insights for potential therapeutic applications.

How does CSTF2T differ functionally from the related protein CSTF2?

While both CSTF2T and CSTF2 function in mRNA 3' end processing, they exhibit important differences:

• Expression pattern: CSTF2 is widely expressed across many tissue types, whereas CSTF2T shows restricted expression primarily in testis under normal conditions

• Substrate specificity: CSTF2T plays a role in AAUAAA-independent mRNA polyadenylation, suggesting different sequence preferences compared to CSTF2

• Cancer relevance: CSTF2T shows stronger association with cancer progression and poor prognosis compared to CSTF2

• Evolutionary conservation: While both proteins are conserved across species, they may have evolved distinct functions in RNA processing

Understanding these functional differences is crucial for developing specific therapeutic strategies targeting CSTF2T while minimizing effects on the more ubiquitously expressed CSTF2 .