CYR61 Antibody

How do I select the appropriate CYR61 antibody for my research application?

When selecting a CYR61 antibody, researchers should consider several critical factors:

• Application compatibility: Different antibodies perform optimally in specific applications. For example, the Human Cyr61/CCN1 Antibody (AF6009) functions effectively as an ELISA detection antibody when paired with specific monoclonal antibodies . Similarly, antibodies like the CYR61 (A-10) monoclonal antibody have been validated for multiple applications including Western blot, immunoprecipitation, immunofluorescence, and immunohistochemistry .

• Species reactivity: Verify the antibody's cross-reactivity with your species of interest. Some antibodies, like the CYR61 Polyclonal Antibody (PA1-16579), show predicted reactivity with rat and mouse models based on high sequence homology (88%) .

• Clone specificity: Monoclonal antibodies offer high specificity for particular epitopes. The CYR61 (D4H5D) XP® Rabbit mAb specifically recognizes endogenous levels of total CYR61 protein without cross-reacting with other CCN-family proteins .

• Validation data: Review published validation studies. Look for antibodies with demonstrated specificity in multiple applications and cell types, such as those validated in A549 human lung carcinoma and SK-BR-3 human breast cancer cell lines .

What positive controls should I use when validating a CYR61 antibody?

Selecting appropriate positive controls is essential for antibody validation:

• Cell lines: Cell lines with known endogenous CYR61 expression provide excellent positive controls. The search results indicate that MDA-MB-231 breast cancer cells, A549 human lung carcinoma cells, and SK-BR-3 human breast cancer cells express detectable levels of CYR61 .

• Recombinant protein: Purified recombinant human CYR61 protein can serve as a definitive positive control, particularly for ELISA development and Western blot applications .

• Overexpression systems: Transient overexpression lysates containing CYR61 are recommended as positive controls for antibody testing .

• Tissue samples: For IHC applications, tissues with known CYR61 expression patterns should be used. CYR61 is highly expressed in tissues undergoing active angiogenesis, wound healing, and in various tumor types .

What are the optimal conditions for detecting CYR61 by Western blot?

Western blot detection of CYR61 requires careful optimization:

How can I optimize ELISA detection of CYR61?

ELISA development for CYR61 quantification involves several critical steps:

• Antibody pairing: Effective sandwich ELISA development requires complementary capture and detection antibodies. The human Cyr61/CCN1 antibody (AF6009) functions effectively as a detection antibody when paired with Rat Anti-Human Cyr61/CCN1 Monoclonal Antibody (MAB40551) .

• Protocol optimization: Based on successful ELISA development approaches, the following protocol framework has proven effective:

  • Coat plates with capture antibody (1 μg/ml in 0.05 M Tris-HCl buffer, pH 8.0) overnight at 4°C

  • Block with 1% BSA containing 0.05% Tween 20 in PBS for 2 hours at 37°C

  • Add samples and standards

  • Incubate with detection antibody for 1 hour at 37°C

  • Apply HRP-conjugated secondary antibody for 1 hour at 37°C

  • Develop with TMB substrate and stop with 2M H₂SO₄

• Standard curve development: Serial dilutions of recombinant human CYR61 protein can be used to generate standard curves for quantitative analysis .

What approaches can be used to study CYR61 expression at the mRNA level?

Several methods have been validated for analyzing CYR61 mRNA expression:

• qRT-PCR: The following primers have been successfully used for CYR61 amplification: Forward: ATCCCTGGATTGAAGCGCAA, Reverse: CACTGCAACGTCAAGGTTCG, which amplify a product of 137 bp .

• Protocol considerations:

  • Use 1 μg total RNA for reverse transcription with random primers

  • Perform qRT-PCR using SYBR-based detection systems

  • Include 18S rRNA as a reference gene for normalization

  • Run all samples in triplicate and calculate relative expression using the comparative Ct method

• Sample analysis: This approach has been validated for distinguishing CYR61 expression levels between non-muscle invasive bladder cancers and muscle invasive bladder cancers, demonstrating its utility as a preoperative biomarker .

How does CYR61 antibody blockade affect angiogenesis in experimental models?

CYR61 antibody interference with angiogenesis has been experimentally demonstrated:

• Mechanistic basis: CYR61 promotes angiogenesis by binding to integrin αVβ3 on endothelial cells, stimulating directed cell migration (chemotaxis) and proliferation . Anti-CYR61 antibodies can neutralize these effects.

• Validated approaches:

  • In vitro: Purified CYR61 (10 ng/ml to 5 μg/ml) stimulates dose-dependent migration of human microvascular endothelial cells (HMVECs), and this activity is specifically blocked by anti-CYR61 antibodies but not affected by control antibodies .

  • Checkerboard analysis has confirmed that CYR61 induces directed chemotaxis rather than random chemokinesis, with maximum activity observed in concentration gradient conditions .

• In vivo significance: Beyond in vitro models, CYR61 induces neovascularization in rat corneas, and this activity can be blocked by specific anti-CYR61 antibodies, confirming its role as an angiogenic factor .

What are the implications of CYR61 expression in cancer research?

CYR61 plays significant roles in tumorigenesis that researchers should consider:

• Expression patterns: Most human tumor-derived cell lines express CYR61, suggesting a correlation between CYR61 expression and tumorigenesis. Notable exceptions include the RF-1 gastric adenocarcinoma cell line and its metastatic variant RF-48, which do not express CYR61 and develop only small tumors in immunodeficient mice .

• Functional significance: Experimental expression of CYR61 in non-expressing tumor cells (RF-1) significantly enhances their tumorigenicity, resulting in larger and more vascularized tumors compared to control cells .

• Dual role in cancer: CYR61 exhibits both tumorigenic and tumor suppressor properties depending on the cancer type:

  • Promotes tumorigenesis, angiogenesis, and metastasis in breast, renal, gastric, squamous cell, and colorectal carcinomas and gliomas

  • Acts as a tumor suppressor when downregulated in endometrial, hepatic, and non-small cell lung cancers

• Potential as a biomarker: CYR61 has been investigated as a potential biomarker for preoperative identification of muscle-invasive bladder cancers, highlighting its clinical relevance .

How can binding kinetics of anti-CYR61 antibodies be precisely measured?

Advanced characterization of antibody-antigen interactions provides critical insights:

• Surface plasmon resonance: Biacore analysis represents the gold standard for determining binding kinetics of anti-CYR61 antibodies:

  • Covalently immobilize purified recombinant human CYR61 onto a CM5 sensor chip using amine coupling

  • Inject serial dilutions of anti-CYR61 monoclonal antibodies at 50 μl/min

  • Include Cyr61-irrelevant antibodies as controls

  • Determine association (Ka) and dissociation (Kd) rate constants using appropriate evaluation software

• Evaluation criteria: High-affinity antibodies typically exhibit fast association rates and slow dissociation rates, resulting in low nanomolar or picomolar dissociation constants.

What technical challenges might arise when studying signaling pathways affected by CYR61, and how can they be addressed?

CYR61 influences multiple signaling pathways, creating technical complexities:

• Pathway analysis approaches: The activation of downstream pathways like AKT and ERK (ERK1/ERK2) can be analyzed using phosphorylation-specific antibodies:

  • Prepare cell lysates from models with differential CYR61 expression

  • Run SDS-PAGE and transfer to PVDF membranes

  • Block with 5% non-fat milk and incubate with pathway-specific primary antibodies

  • Apply HRP-conjugated secondary antibodies and detect using ECL systems

• Technical challenges and solutions:

  • CYR61 interacts with multiple integrin receptors (αVβ3, αVβ5, αMβ2, α6β1) and heparan sulfate proteoglycans , creating complex signaling patterns

  • Use specific pathway inhibitors to dissect individual contributions

  • Consider analyzing multiple timepoints to capture transient activation events

  • Include recombinant CYR61 treatments to normalize pathway activation

What considerations are critical when designing functional blocking studies with anti-CYR61 antibodies?

Functional studies require careful experimental design:

What steps should be taken when CYR61 detection produces inconsistent results?

Troubleshooting CYR61 detection requires systematic evaluation:

• Sample preparation assessment:

  • CYR61 is a secreted protein that may be present in both cell lysates and conditioned media

  • Ensure proper extraction conditions to solubilize matrix-associated CYR61

  • Consider using protease inhibitors to prevent degradation

  • For secreted protein analysis, concentrate conditioned media using appropriate methods

• Technical optimization:

  • Verify antibody quality and specificity with positive controls (e.g., recombinant CYR61)

  • Optimize antibody dilutions - for instance, CYR61 (D4H5D) XP® Rabbit mAb requires 1:1000 dilution for Western blot but 1:50-1:100 for immunofluorescence

  • Adjust blocking conditions to reduce background signals

  • Consider using alternative detection systems if sensitivity is insufficient

• Biological variables:

  • CYR61 expression is regulated by growth factors and stress conditions

  • Standardize culture conditions to minimize variability

  • Consider analyzing multiple timepoints as CYR61 is an immediate-early gene product

  • Take into account potential post-translational modifications that may affect antibody recognition

How can researchers distinguish between specific and non-specific signals when working with CYR61 antibodies?

Distinguishing genuine CYR61 signals requires rigorous controls:

• Essential validation controls:

  • Positive controls: Use cell lines with confirmed CYR61 expression (e.g., A549, SK-BR-3)

  • Negative controls: Include cell lines lacking CYR61 expression (e.g., RF-1)

  • Competitive inhibition: Pre-incubate antibodies with purified CYR61 protein to block specific binding

  • Isotype controls: Use matched isotype antibodies to identify non-specific binding

  • Genetic validation: Compare results from CYR61 knockdown/knockout cells

• Technical approach:

  • For immunostaining, pre-incubation of anti-CYR61 antibodies with purified CYR61 protein should abolish specific immunostaining, as demonstrated in tumor models

  • For Western blotting, specific bands should appear at the expected molecular weight (approximately 40-45 kDa) and be absent in negative controls

  • Multiple antibodies targeting different epitopes can provide stronger evidence of specificity

How might CYR61 antibodies be utilized in emerging therapeutic approaches?

CYR61 represents a promising therapeutic target with several developing approaches:

• Therapeutic potential: Anti-CYR61 antibodies have shown promise in inhibiting breast cancer growth and metastasis, providing direct evidence that CYR61 can serve as a potent therapeutic target for patients with high CYR61 expression breast cancer .

• Mechanistic considerations:

  • CYR61 promotes angiogenesis through interaction with integrin αVβ3

  • It functions as an extracellular matrix-associated signaling molecule that promotes cell adhesion, migration, and proliferation

  • Blocking these functions through antibody neutralization could inhibit tumor growth and metastasis

• Emerging applications:

  • Combination therapies with existing anti-angiogenic agents

  • Development of humanized anti-CYR61 antibodies for clinical applications

  • Antibody-drug conjugates targeting CYR61-expressing tumors

  • Biomarker-guided patient stratification for targeted therapies

What novel applications of CYR61 antibodies are emerging beyond cancer research?

CYR61 functions extend beyond oncology, opening additional research directions:

• Wound healing applications: CYR61 is upregulated in injured skin and bone, where it induces expression of growth factors, cytokines, proteases, and integrins involved in wound repair . Antibodies could be used to study this process or modulate healing responses.

• Cardiovascular research: Given its role in angiogenesis and vascular remodeling, CYR61 antibodies may provide insights into cardiovascular diseases and potential therapeutic approaches.

• Inflammatory conditions: CYR61 interacts with the integrin αMβ2 , suggesting involvement in inflammatory processes that could be studied using specific antibodies.

• Developmental biology: CYR61 expression is tissue-specific and temporally regulated during development , making it a valuable target for developmental studies using appropriate antibodies.