DHX30 Antibody

What is DHX30 and what are its primary cellular functions?

DHX30 is an ATP-dependent RNA helicase that plays multiple important roles in cellular function. This protein is involved in several critical cellular processes:

• Assembly of the mitochondrial large ribosomal subunit

• Supporting optimal function of zinc-finger antiviral protein ZC3HAV1

• Association with mitochondrial DNA

• Nervous system development and differentiation through up-regulation of genes required for neurogenesis, including GSC, NCAM1, neurogenin, and NEUROD

• Coordination of cytoplasmic translation and mitochondrial function

• Regulation of p53-dependent apoptosis

DHX30 is highly expressed in neural cells and somites during embryogenesis in mice, and its homozygous deletion is embryonic lethal, indicating its crucial developmental role . Recent studies have identified de novo missense mutations in the highly conserved helicase motif of DHX30 in patients with neurodevelopmental disorders, suggesting its importance in proper brain development .

What applications can DHX30 antibodies be used for in research laboratories?

DHX30 antibodies have been validated for several important research applications:

For Western blotting applications, DHX30 antibodies have been successfully used to detect the protein in whole cell lysates from various cell lines including HeLa and 293T at protein amounts ranging from 5-50 μg per lane . When performing RNA immunoprecipitation, DHX30 antibodies can help identify RNA transcripts associated with DHX30, which has been crucial for understanding its role in translation regulation .

How can I validate the specificity of DHX30 antibodies in my experimental system?

Proper validation of DHX30 antibodies is essential for experimental reliability. Consider these methodological approaches:

• Genetic validation:

  • Compare antibody reactivity in wild-type versus DHX30 knockout or knockdown samples

  • DHX30-deficient cell lines can be generated using CRISPR/Cas9 with guide RNAs targeting exon 7 (CGAGTGCTAGCTGATCGCTT) or other regions

• Multiple antibody approach:

  • Use antibodies recognizing different epitopes of DHX30

  • Compare reactivity patterns to ensure consistency

• Predicted molecular weight verification:

  • Confirm detection at the expected molecular weight (~130 kDa)

  • Check for isoform-specific patterns where applicable

• Positive controls:

  • Include samples with known DHX30 expression (e.g., neural cells)

  • Consider using recombinant DHX30 protein as a reference standard

• Blocking peptide experiments:

  • Pre-incubate antibody with the immunizing peptide

  • Verify signal disappearance in blocked samples

The generation of DHX30 knockout validation controls has been documented using CRISPR/Cas9 in HEK293T cells , providing an excellent negative control for antibody validation.

How does DHX30 coordinate cytoplasmic translation and mitochondrial function, and how can I study this experimentally?

DHX30 functions as a regulatory bridge between cytoplasmic and mitochondrial translation systems. Research has revealed several key aspects of this coordination:

To experimentally study these functions:

• Polysome profiling with DHX30 analysis:

  • Fractionate cell lysates on sucrose gradients

  • Analyze DHX30 distribution across monosome and polysome fractions by Western blotting

  • Extract RNA from fractions for RT-qPCR or RNA-seq to identify affected transcripts

• Translational efficiency measurement:

  • Compare total RNA-seq with polysome-associated RNA-seq in control versus DHX30-depleted cells

  • Calculate translational efficiency as the ratio of polysomal to total mRNA

  • Perform gene set enrichment analysis (GSEA) to identify affected pathways

• Isoform-specific studies:

  • Design experiments targeting cytoplasmic versus mitochondrial DHX30 isoforms

  • Perform subcellular fractionation to separate cytoplasmic and mitochondrial components

  • Analyze each fraction for DHX30 distribution and function

DHX30 depletion was shown to enhance global translation while simultaneously reducing mitochondrial energy metabolism, suggesting an important role in coordinating these processes for optimal cellular homeostasis .

What methods can I use to identify RNA transcripts directly bound by DHX30?

Identifying DHX30's RNA targets is crucial for understanding its molecular functions. Several complementary techniques can be employed:

• RNA Immunoprecipitation (RIP):

  • Prepare cell lysates in NT2 buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM MgCl₂, 0.05% NP40) with RNase inhibitors

  • Pre-clear lysates with Protein A/G Dynabeads

  • Immunoprecipitate DHX30 using specific antibodies (5 μg of Bethyl A302-218A has been validated)

  • Perform multiple stringent washes to reduce background

  • Extract RNA using TRIzol and analyze by RT-qPCR or RNA-seq

• eCLIP (enhanced Crosslinking and Immunoprecipitation):

  • This technique has been successfully used to identify DHX30 RNA targets in ENCODE datasets

  • It provides higher resolution of binding sites compared to standard RIP

  • Combined with RIP data, it allows for identification of high-confidence direct targets

• Integration of multiple datasets:

  • Combine differential translational efficiency (TE) data with direct binding data

  • Perform pathway analysis to identify functional clusters of DHX30-bound transcripts

  • Validate key targets with focused experimental approaches

Using this integrated approach, researchers have identified 14 mitoribosomal protein (MRP) transcripts as high-confidence DHX30 direct targets . These transcripts show reduced translational efficiency upon DHX30 depletion and are directly bound by DHX30 according to RIP and eCLIP data.

What are the optimal conditions for DHX30 antibody-based Western blotting?

Successful Western blotting for DHX30 requires careful optimization of experimental conditions:

DHX30 antibodies have successfully detected the protein in multiple cell lines including HeLa, 293T, HCT116, MCF7, and U2OS . When optimizing your Western blot protocol, consider:

• Controls:

  • Include DHX30 knockout or knockdown samples as negative controls

  • Use multiple antibodies targeting different epitopes if available

  • Consider cell lines with known high DHX30 expression as positive controls

• Troubleshooting tips:

  • If signal is weak, increase antibody concentration or exposure time

  • If background is high, increase washing stringency

  • For large proteins like DHX30, ensure sufficient transfer time

  • Consider using gradient gels for better resolution

Data from published studies show successful detection of DHX30 in as little as 5 μg of whole cell lysate when using optimized conditions .

How can I generate and validate DHX30 knockout or knockdown models for my research?

Creating DHX30-deficient models is valuable for functional studies and antibody validation:

• CRISPR/Cas9 knockout generation:

  • Design considerations:

    • Target early exons (exon 7 has been successfully targeted)

    • Validated sgRNA sequences include:

      • CGAGTGCTAGCTGATCGCTT (targeting exon 7 in human cells)

      • TCAAGTTCAGCTGCACGGAT (used in zebrafish models)

    • Use plasmids encoding sgRNA, Cas9, and selection marker (e.g., pLentiCRISPR v2)

  • Screening workflow:

    1. Transfect cells and select with appropriate antibiotic (e.g., puromycin)

    2. Isolate single cell clones by limiting dilution or cell sorting

    3. Expand clones and screen for DHX30 expression by Western blotting

    4. Confirm genomic modifications by PCR and sequencing

    5. Validate functional changes (translation effects, mitochondrial function)

• RNA interference approaches:

  • siRNA or shRNA targeting DHX30 can be used for transient knockdown

  • Multiple targeting sequences should be tested for efficiency

  • Consider designing constructs that target specific DHX30 isoforms

• Validation strategies:

  • Western blotting to confirm protein depletion

  • RT-qPCR to assess mRNA levels

  • Functional assays focusing on known DHX30 roles:

    • Global translation measurements

    • Mitochondrial function assessment

    • Stress granule formation

    • RNA binding capacity

• Rescue experiments:

  • Reintroduce wild-type DHX30 to confirm phenotype specificity

  • Test mutant versions to identify critical functional domains

  • Consider inducible expression systems for temporal control

Published protocols have documented successful generation of DHX30 knockout in HEK293T cells and zebrafish models using CRISPR/Cas9 approaches , providing validated methodologies for researchers.

What approaches can I use to study DHX30's role in translation regulation?

DHX30's complex role in translation can be investigated using several complementary approaches:

• Polysome profiling:

  • Methodology:

    1. Prepare cytoplasmic extracts with cycloheximide to freeze ribosomes

    2. Layer extracts on 10-50% sucrose gradients

    3. Ultracentrifuge to separate ribosomal components

    4. Fractionate while monitoring UV absorbance

    5. Collect fractions for protein and RNA analysis

  • Analysis options:

    • Western blot fractions to detect DHX30 association with ribosomes

    • Extract RNA from fractions for RT-qPCR or RNA-seq

    • Compare profiles between wild-type and DHX30-depleted cells

• Translational efficiency analysis:

  Analysis Approach	Description	Applications
  Total vs. Polysomal RNA-seq	Compare abundance in total cellular RNA versus polysome-associated RNA	Identify transcripts with altered translational efficiency
  Ribosome profiling	Sequence ribosome-protected mRNA fragments	Map ribosome positions with nucleotide resolution
  Pulsed SILAC	Label newly synthesized proteins with heavy amino acids	Quantify translation rates for specific proteins

• Global translation measurements:

  • Puromycin incorporation (SUnSET method) to measure nascent protein synthesis

  • Metabolic labeling with [35S]-methionine/cysteine

  • Quantification of ribosomes from sucrose cushions

  • Analysis of rRNA levels by RT-qPCR or Northern blotting

• Stress granule analysis:

  • DHX30 mutations can trigger stress granule formation

  • Immunofluorescence microscopy to visualize stress granules

  • Co-localization studies with established stress granule markers

  • Time-course analysis of formation and resolution

Research has shown that DHX30 depletion enhances the translation of mRNAs coding for cytoplasmic ribosomal proteins (RPL and RPS) while reducing the translational efficiency of nuclear-encoded mitoribosome mRNAs . These findings suggest DHX30 plays a role in coordinating cytoplasmic and mitochondrial translation, which can be further investigated using the approaches described.

How can I distinguish between the functions of cytoplasmic versus mitochondrial DHX30 isoforms?

DHX30 has both cytoplasmic and mitochondrial isoforms, with the mitochondrial one being more abundant . Differentiating their functions requires specialized approaches:

Research has demonstrated that cytoplasmic DHX30 appears to modulate global translation, while the mitochondrial isoform influences mitoribosome assembly and mitochondrial function . Understanding this dual role is critical for properly interpreting experimental results.

What controls should I include when performing DHX30 RNA immunoprecipitation (RIP) experiments?

RNA immunoprecipitation is a powerful technique for identifying DHX30-associated transcripts, but proper controls are essential:

• Essential controls for DHX30 RIP:

  Control Type	Purpose	Implementation
  Input samples	Normalize for starting RNA abundance	Reserve 1-5% of pre-cleared lysate
  IgG control IP	Assess non-specific binding	Perform parallel IP with isotype-matched IgG
  DHX30 knockout/knockdown	Validate antibody specificity	Use cells depleted of DHX30
  RNase treatment	Confirm RNA-dependent interactions	Treat samples with RNase A before IP
  RT-minus	Verify absence of DNA contamination	Perform reverse transcription without enzyme

• RIP protocol optimization:

  • Pre-clear lysates with Protein A/G beads to reduce background

  • Include RNase inhibitors in all buffers to preserve RNA integrity

  • Perform stringent washes (e.g., NT2 buffer with 0.1% Urea + 50 mM NaCl)

  • Consider crosslinking for more transient interactions

• Validation of RIP results:

  • Confirm enrichment of known or predicted targets

  • Test multiple primer sets per target to validate results

  • Compare results with eCLIP or other binding data

  • Functional validation through target transcript manipulation

• Data analysis considerations:

  • Calculate fold enrichment relative to IgG and input controls

  • Set appropriate significance thresholds

  • Perform motif analysis on enriched transcripts

  • Consider secondary structure of bound RNAs

Published DHX30 RIP protocols have successfully identified mitoribosomal protein transcripts as direct DHX30 targets, using 5 μg of DHX30-specific antibody (Bethyl A302-218A) for immunoprecipitation .

How can I resolve contradictory results between DHX30 antibodies or across different cell types?

When facing conflicting results in DHX30 research, systematic troubleshooting is needed:

• Antibody-related discrepancies:

  Possible Issue	Investigation Approach	Resolution Strategy
  Epitope accessibility	Test multiple antibodies targeting different regions	Use antibody combinations for confirmation
  Cross-reactivity	Verify specificity in knockout/knockdown systems	Select most specific antibody for continued use
  Application suitability	Test antibodies in multiple applications	Some antibodies work better for WB than IP or IHC
  Lot-to-lot variation	Compare antibody lots using consistent samples	Maintain reference samples for standardization

• Cell type-specific differences:

  • Verify DHX30 expression levels across cell types

  • Check relative abundance of DHX30 isoforms

  • Consider cell-specific interaction partners

  • Examine energy metabolism and translation requirements

• Experimental validation approaches:

  • Use multiple methodologies to corroborate findings

  • Perform rescue experiments with wild-type DHX30

  • Consider developmental stage or differentiation status

  • Examine pathway activation states that influence DHX30 function

• Integrated analysis:

  • Look for core conserved functions versus cell-type specific roles

  • Compare results in normal versus disease contexts

  • Consider tissue-specific post-translational modifications

Research has shown varied effects of DHX30 depletion in different cell lines (HCT116, U2OS, MCF7) , suggesting context-dependent functions. These differences likely reflect the complex role of DHX30 in coordinating cytoplasmic and mitochondrial translation, which may be differentially regulated based on cellular metabolic demands.

What is the relationship between DHX30 and neurodevelopmental disorders, and how can I study this experimentally?

DHX30 mutations have been linked to neurodevelopmental disorders characterized by global developmental delay, intellectual disability, severe speech impairment, and gait abnormalities . Investigating this relationship requires specialized approaches:

• Mutation characterization:

  • De novo missense mutations typically occur in the conserved helicase motif

  • These mutations impair ATPase activity or RNA recognition

  • Mutant DHX30 shows increased propensity to trigger stress granule formation

  • Global translation is decreased in cells expressing DHX30 mutants

• Experimental models:

  Model System	Advantages	Limitations	Key Assays
  Patient-derived cells	Disease-relevant mutations	Limited accessibility	Translation analysis, RNA binding
  CRISPR-edited cell lines	Precise mutation introduction	Not neuronal context	Molecular mechanisms, stress response
  iPSC-derived neurons	Human neuronal context	Technical complexity	Neuronal development, synapse formation
  Zebrafish models	In vivo developmental assessment	Evolutionary distance	Behavioral analysis, brain development
  Mouse models	Mammalian brain development	Time and resource intensive	Comprehensive neurological assessment

• Neuronal differentiation assays:

  • DHX30 is involved in the up-regulation of genes required for neurogenesis (GSC, NCAM1, neurogenin, NEUROD)

  • Monitor expression of these markers in differentiation models

  • Assess neurite outgrowth and synapse formation

  • Evaluate electrophysiological properties of developing neurons

• Translation regulation in neurons:

  • Investigate local translation at synapses

  • Identify neuron-specific DHX30 RNA targets

  • Study potential interactions with other RNA-binding proteins involved in neurodevelopmental disorders

  • Assess stress granule dynamics in neuronal models

Understanding DHX30's connection to neurodevelopmental disorders offers opportunities for therapeutic development. Since DHX30 mutations affect translation and stress responses, approaches targeting these pathways might provide avenues for intervention in affected patients.