DPP9 Antibody, HRP conjugated

What is DPP9 and what are its primary biological functions?

Dipeptidyl Peptidase 9 (DPP9) is an aminopeptidase that cleaves N-terminal dipeptides from proteins containing proline or alanine at position 2. DPP9 plays significant roles in multiple cellular pathways including cell survival, metabolism, and immune regulation. It functions as a key inhibitor of caspase-1-dependent monocyte and macrophage pyroptosis in resting cells by preventing activation of NLRP1 and CARD8. Furthermore, DPP9 sequesters the cleaved C-terminal parts of NLRP1 and CARD8 in a ternary complex, thereby preventing their oligomerization and subsequent activation of inflammasomes .

In signaling pathways, DPP9 serves as a negative regulator of Syk, a central kinase in B-cell signaling. Research has demonstrated that DPP9 cleaves Syk to produce a neo N-terminus with serine in position 1, which influences Syk stability and represents a novel component of the N-end rule pathway .

What does HRP conjugation mean for a DPP9 antibody?

HRP (Horseradish Peroxidase) conjugation refers to the chemical linking of the enzyme horseradish peroxidase to an antibody, in this case, a DPP9-specific antibody. This conjugation creates a detection system where the antibody provides specificity for DPP9 binding, while the HRP enzyme generates a detectable signal through substrate conversion.

The HRP conjugation enables direct detection in assays like ELISA and Western blots without requiring secondary antibodies, thereby reducing experimental steps and potential sources of background noise. The DPP9 antibody (AA 289-437) conjugated to HRP is specifically designed for ELISA applications with high specificity toward human DPP9 protein .

What are the standard application methods for DPP9 antibody (HRP conjugated)?

The primary application for DPP9 antibody (HRP conjugated) is ELISA (Enzyme-Linked Immunosorbent Assay). This conjugated antibody enables direct detection without the need for secondary antibodies, simplifying the protocol and potentially reducing background signals. Optimal working dilution should be determined by the investigator for each specific experimental setup .

Other DPP9 antibodies (non-HRP conjugated) are applicable for Western Blotting (WB), Immunohistochemistry (IHC), Flow Cytometry (FACS), Immunoprecipitation (IP), and Immunofluorescence (IF), depending on the specific clone and format. When selecting a DPP9 antibody for these alternative applications, researchers should consider the target species, epitope recognition, and validated applications listed in the product specifications .

How should I validate the specificity of DPP9 antibody (HRP conjugated) in my experimental system?

Validating antibody specificity is crucial for research integrity. For DPP9 antibody (HRP conjugated), implement these methodological approaches:

• Positive and negative controls: Include DPP9-expressing cells/tissues and DPP9-negative samples in your experiments. For human samples, be aware that this particular antibody (AA 289-437) has been specifically validated against human DPP9 .

• Knockdown/knockout validation: Utilize DPP9 knockdown or knockout cell lines as negative controls. This can be achieved using AAV vectors with specific gRNA sequences for DPP9 knockdown, such as 3'CCCCATAGACAAAGAGCACAGTG5' and 3'AGTCTCGATGTTTGCCCACCCACA5', as utilized in published research .

• Peptide competition assay: Pre-incubate the antibody with excess purified DPP9 protein or the immunogen peptide (AA 289-437) before application to your samples. This should abolish specific binding.

• Cross-reactivity assessment: Even though this antibody is validated for human DPP9, test for cross-reactivity with other DPP family members (DPP4, DPP8) if they might be present in your experimental system.

• Isotype control: Use a rabbit polyclonal IgG (matching the DPP9 antibody isotype) conjugated to HRP as a negative control to assess non-specific binding .

What are the optimal sample preparation methods for detecting DPP9 using HRP-conjugated antibodies?

Optimal sample preparation depends on your experimental system and detection method. For ELISA applications with DPP9 antibody (HRP conjugated), follow these methodological considerations:

• Protein extraction: Use a mild lysis buffer containing protease inhibitors to preserve DPP9 structure and enzymatic activity. For cellular samples, a buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, and protease inhibitor cocktail is typically effective.

• Sample dilution: Prepare a dilution series of your samples to determine the optimal concentration for detection within the linear range of the assay.

• Blocking conditions: Use 3-5% BSA or milk protein in TBS-T (Tris-buffered saline with 0.05% Tween-20) to reduce background.

• Antibody dilution: Start with the manufacturer's recommended dilution range but optimize through titration experiments. The optimal working dilution should be determined empirically for your specific experimental conditions .

• Signal detection optimization: For HRP detection, both colorimetric (TMB, ABTS) and chemiluminescent substrates work well. Choose based on your desired sensitivity and detection equipment availability.

How can I monitor DPP9 expression and localization changes during experimental interventions?

To effectively monitor DPP9 expression and localization changes, consider these methodological approaches:

• Quantitative analysis: For expression level changes, combine HRP-conjugated DPP9 antibody in ELISA with other quantitative methods such as Western blotting or qPCR for mRNA levels.

• Cellular localization: Immunofluorescence microscopy reveals that DPP9 localization can be altered under certain conditions. For example, research has shown that silencing of Filamin A (FLNA) can change DPP9's distribution between cytosolic and nuclear compartments . Quantify this distribution using parameters such as:

  • n = c: DPP9 equally distributed in cytosol and nucleus

  • n > c: Stronger DPP9 staining in nucleus compared to cytosol

• Protein-protein interactions: Monitor DPP9 interactions with known partners like FLNA and Syk using proximity ligation assay (PLA). Research has demonstrated that the DPP9-Syk interaction depends on the presence of FLNA .

• Activity assessment: Measure DPP9 enzymatic activity using artificial substrates like GP-AMC (250 μM) and compare to unrelated substrates like R-AMC (50 μM) to confirm specificity. Treatment with DPP8/9 inhibitors like 1G244 (10 μM) can be used as controls .

How does DPP9 participate in the N-end rule pathway, and how can antibodies help investigate this mechanism?

DPP9 functions as a novel component of the N-end rule pathway, which regulates protein degradation based on the identity of proteins' N-terminal residues. Research has revealed that:

• DPP9's role in Syk regulation: DPP9 cleaves Syk to produce a neo N-terminus with serine in position 1. This modification strongly influences Syk stability, as demonstrated through pulse-chase and mutagenesis studies .

• Interaction with ubiquitination machinery: DPP9 processing appears to be a prerequisite for Syk ubiquitination by the E3 ligase Cbl. DPP9 silencing reduces Cbl interaction with Syk, demonstrating its role in targeting proteins for degradation .

• Methodological approach for investigation: To investigate this mechanism, researchers can employ:

  • Immunoprecipitation with DPP9 antibodies to isolate DPP9-protein complexes

  • Western blotting to analyze ubiquitination levels of suspected substrates

  • Pulse-chase experiments with protein synthesis inhibitors to measure turnover rates

  • Site-directed mutagenesis of N-terminal residues to validate N-end rule applicability

• Inhibition studies: DPP9 inhibition stabilizes Syk, modulating Syk signaling. This provides an experimental approach to validate DPP9's role in protein degradation pathways .

What approaches can be used to investigate the relationship between DPP9 enzymatic activity and memory regulation?

Recent research has demonstrated a bidirectional relationship between hippocampal DPP9 and memory regulation. To investigate this connection, consider these methodological approaches:

• Genetic manipulation: Use AAV vectors for DPP9 knockdown or overexpression in specific brain regions. For knockdown, employ AAV2/9-CMV-Cax13d-FLAG-U6-2x gRNA with specific sequences (3'CCCCATAGACAAAGAGCACAGTG5' and 3'AGTCTCGATGTTTGCCCACCCACA5'). For overexpression, use AAV2/9-hSyn-DPP9-FLAG mixed with AAV2/9-hSyn-GFP-WPRA for visualization .

• Enzymatic activity assays: Measure DPP9 activity in brain tissue samples using appropriate substrates that are cleaved by DPP9. Compare this activity between control and experimental conditions.

• Protein interaction analysis: Investigate DPP9 interactions with synaptic and memory-related proteins using techniques such as co-immunoprecipitation, proximity ligation assays, or mass spectrometry-based proteomics.

• Functional assays: Correlate DPP9 activity with memory performance using behavioral tests after DPP9 manipulation.

• Signaling pathway investigation: Analyze downstream effects of DPP9 activity on signaling pathways known to be involved in memory formation and consolidation.

How can I troubleshoot inconsistent results when using DPP9 antibody (HRP conjugated) in ELISA assays?

When encountering inconsistent results with DPP9 antibody (HRP conjugated) in ELISA assays, consider these methodological troubleshooting approaches:

• Antibody degradation: HRP conjugates can lose activity over time. Verify enzyme activity using a simple HRP substrate test. Store antibody according to manufacturer recommendations, typically at 2-8°C and protected from light. Avoid repeated freeze-thaw cycles.

• Epitope accessibility: The DPP9 antibody (AA 289-437) targets a specific region; ensure your sample preparation doesn't mask this epitope. Try different sample preparation methods if detection is consistently poor.

• Cross-reactivity assessment: Test for potential cross-reactivity with other DPP family members. Include controls with recombinant DPP4 and DPP8 proteins to verify specificity.

• Blocking optimization: Insufficient blocking can lead to high background, while excessive blocking might mask epitopes. Optimize blocking conditions by testing different agents (BSA, milk protein, commercial blockers) and concentrations.

• Substrate considerations: HRP detection sensitivity depends on the substrate. If signal is weak, consider switching from colorimetric (TMB, ABTS) to chemiluminescent substrates for enhanced sensitivity.

• Sample matrix effects: Components in your sample matrix might interfere with antibody binding or HRP activity. Test serial dilutions of your sample to identify and minimize matrix effects.

What is the significance of DPP9's interaction with Filamin A and Syk in immune cell signaling?

Research has revealed a crucial signaling axis involving DPP9, Filamin A (FLNA), and Spleen tyrosine kinase (Syk) that impacts immune cell function. The key findings are:

• Scaffold function of FLNA: FLNA serves as a scaffold that links DPP9 to Syk. This interaction was identified through yeast two-hybrid screening of a human placenta library with DPP9 as bait. The binding surface was mapped to residues 748-907 of FLNA, corresponding to FLNA repeats 5-7 .

• Cellular localization impact: The presence of FLNA affects DPP9 cellular localization. In FLNA-silenced HeLa cells, DPP9 distribution shifts significantly, with quantifiable changes in nuclear versus cytosolic distribution :

  Cell Condition	DPP9 equally distributed (n=c)	DPP9 nuclear > cytosolic (n>c)
  Control siRNA	~65%	~35%
  FLNA siRNA	~40%	~60%

• DPP9-Syk interaction dependency: The interaction between DPP9 and Syk strongly depends on FLNA presence. Proximity ligation assay (PLA) demonstrates significantly reduced DPP9-Syk interaction signals in FLNA-silenced cells .

• Functional consequences: DPP9 negatively regulates Syk signaling by promoting its degradation through the N-end rule pathway. This represents a novel regulatory mechanism for controlling immune cell signaling intensity and duration .

How does DPP9 influence inflammasome activation, and what experimental approaches can verify this role?

DPP9 plays a critical regulatory role in inflammasome activation, particularly through its interactions with NLRP1 and CARD8. Understanding this function requires careful experimental approaches:

• Inhibition of inflammasome components: DPP9 acts as a key inhibitor of caspase-1-dependent monocyte and macrophage pyroptosis in resting cells by preventing activation of NLRP1 and CARD8 .

• Sequestration mechanism: DPP9 sequesters the cleaved C-terminal parts of NLRP1 and CARD8 (which constitute the active parts of these inflammasomes) in a ternary complex, thereby preventing their oligomerization and activation .

• Enzymatic activity requirement: The dipeptidyl peptidase activity of DPP9 is required to suppress NLRP1 and CARD8, although interestingly, neither appears to be direct substrates of DPP9. This suggests the existence of other substrate(s) required for NLRP1 and CARD8 inhibition .

• Experimental verification approaches:

  • Use selective DPP8/9 inhibitors (e.g., 1G244) to assess inflammasome activation

  • Employ genetic knockdown of DPP9 using validated gRNA sequences

  • Measure pyroptosis markers and caspase-1 activation after DPP9 manipulation

  • Utilize proximity ligation assays to detect DPP9 interactions with inflammasome components

  • Perform co-immunoprecipitation studies to isolate and characterize the ternary complex

What are the latest findings on DPP9's role in hippocampal memory regulation, and how might this impact neuroscience research?

Recent research has revealed bidirectional effects of DPP9 on hippocampal memory regulation, opening new avenues for neuroscience investigation:

• Bidirectional regulation: DPP9 has been demonstrated to bidirectionally regulate memory-related proteins in the hippocampus, suggesting its importance in cognitive processes .

• Enzymatic activity correlation: The enzymatic activity of DPP9 directly affects memory, indicating a functional rather than merely structural role in neural processes .

• Experimental manipulation: Researchers have successfully manipulated DPP9 levels in the hippocampus using AAV vectors:

  • For knockdown: AAV2/9-CMV-Cax13d-FLAG-U6-2x gRNA (DPP9) with specific gRNA sequences

  • For overexpression: AAV2/9-hSyn-DPP9-FLAG

• Research implications: These findings suggest that DPP9 could be a potential target for addressing memory-related disorders. Future research directions might include:

  • Identifying the specific synaptic and memory-related proteins regulated by DPP9

  • Investigating the signaling pathways connecting DPP9 activity to memory formation

  • Exploring potential therapeutic applications targeting DPP9 for cognitive enhancement or treating memory disorders

  • Examining DPP9's role in different memory types (working, spatial, associative) and across different brain regions

What are the critical factors to consider when using DPP9 antibodies in co-localization studies with other cellular markers?

When conducting co-localization studies involving DPP9 antibodies, researchers should consider these critical methodological factors:

• Antibody compatibility: When using DPP9 antibody in combination with other antibodies, ensure they are raised in different host species to avoid cross-reactivity in secondary antibody detection. The DPP9 antibody (AA 289-437) is raised in rabbit , so pair it with antibodies raised in mouse, goat, or other non-rabbit hosts.

• Spectral separation: For HRP-conjugated antibodies in brightfield microscopy, use different chromogenic substrates with distinct colors for multiple targets. For fluorescence microscopy with non-HRP conjugated DPP9 antibodies, ensure adequate spectral separation between fluorophores.

• Sequential staining: Consider sequential rather than simultaneous staining when using antibodies that might cross-react or when targeting proteins that interact with DPP9, like FLNA or Syk.

• Subcellular localization patterns: DPP9 shows both cytosolic and nuclear distribution, which can be altered under different conditions such as FLNA silencing . Use appropriate nuclear and cytoskeletal markers to correctly interpret localization patterns.

• Controls for co-localization: Include both positive controls (proteins known to co-localize with DPP9, such as FLNA) and negative controls (proteins not expected to share localization with DPP9) to validate your co-localization analysis.

• Quantitative analysis: Employ appropriate co-localization coefficients (Pearson's, Mander's) and analysis software to quantify the degree of co-localization rather than relying solely on visual assessment.

How should researchers interpret changes in DPP9 levels versus changes in DPP9 activity in experimental systems?

The distinction between DPP9 protein levels and enzymatic activity is crucial for accurate data interpretation:

• Independent regulation: Protein expression and enzymatic activity can be regulated independently. An increase in DPP9 protein levels (detectable by antibodies) doesn't necessarily translate to proportional increases in enzymatic activity.

• Activity assays: Measure DPP9 enzymatic activity using specific substrates like GP-AMC (250 μM). Compare with unrelated substrates like R-AMC (50 μM) as controls . Monitor fluorescence over time to quantify activity.

• Inhibitor studies: Use DPP8/9 inhibitors like 1G244 (10 μM) to distinguish between activity-dependent and activity-independent functions of DPP9 . This approach can help determine whether observed effects require DPP9's enzymatic activity.

• Correlation analysis: When both measurements are available, analyze the correlation between DPP9 protein levels and enzymatic activity across experimental conditions to identify potential post-translational regulation.

• Functional outcomes: In memory studies, determine whether changes in cognitive performance correlate better with DPP9 protein levels or enzymatic activity to understand the functional significance of each parameter .

• Experimental controls: Include enzymatically inactive DPP9 mutants in overexpression studies to distinguish between scaffold functions and catalytic functions of the protein.

What new developments in DPP9 research might influence antibody selection and experimental design?

Recent advances in DPP9 research have important implications for antibody selection and experimental design:

• Inflammasome regulation: The discovery of DPP9's role in inhibiting inflammasome activation through NLRP1 and CARD8 sequestration suggests that antibodies targeting different DPP9 epitopes might differentially affect these interactions . Consider epitope location when selecting antibodies for inflammasome studies.

• N-end rule pathway: DPP9's function in the N-end rule pathway requires its enzymatic activity to process substrates like Syk . For such studies, complement antibody-based detection with activity assays and consider antibodies that don't interfere with the catalytic site.

• Subcellular shuttling: The observation that DPP9 can shuttle between cytosolic and nuclear compartments depending on FLNA status suggests that fixation methods and cell treatment conditions may significantly affect antibody staining patterns. Document these parameters carefully in experimental reports.

• Memory regulation: The bidirectional effect of DPP9 on memory-related processes opens opportunities for studying DPP9 in neuroscience contexts. Consider antibodies validated in neural tissues and with appropriate reactivity for your model organism.

• Novel interaction partners: As new DPP9 binding partners are discovered, antibody selection should consider whether the epitope overlaps with interaction domains. For example, antibodies targeting the FLNA-binding region might interfere with the DPP9-FLNA-Syk axis .

• Emerging applications: Consider the growing range of applications beyond traditional Western blotting and immunohistochemistry, such as proximity ligation assays for studying DPP9 protein interactions or live-cell imaging techniques that require non-interfering antibodies or fusion proteins.