DPYSL3 Antibody

What is DPYSL3 and what cellular functions does it regulate?

DPYSL3, also named CRMP4, belongs to the cytosolic phosphoprotein family and mediates semaphorin/collapsin-induced growth cone collapse in neuronal cells . Beyond its neuronal functions, DPYSL3 plays crucial roles in cell motility, invasion, and metastasis across multiple cancer types, particularly in pancreatic ductal adenocarcinoma (PDAC) and lung cancer . The protein has been shown to interact with key components of cellular adhesion complexes, including ezrin (EZR), focal adhesion kinase (FAK), talin-1 (TLN1), and c-Src, suggesting its involvement in regulating cell adhesion mechanisms that contribute to the development of metastatic phenotypes . Additionally, DPYSL3 expression is modified in neurodegenerative conditions and participates in ALS-associated pathways including axonal transport, glutamate excitotoxicity, and oxidative stress .

How is DPYSL3 expression regulated in normal tissues versus disease states?

In normal pancreatic duct epithelium, DPYSL3 expression is minimal or undetectable by western blotting, while significantly elevated expression is observed in pancreatic ductal adenocarcinoma (PDAC) tissues . Quantitative proteomic profiling using iTRAQ technology has demonstrated that DPYSL3 protein expression was observed in 16 of 22 (77.7%) PDAC tissue samples, whereas no DPYSL3 signal was detected in the three mucinous pancreatic ductal (MPD) specimens that served as controls . In neurological contexts, alterations in DPYSL3 expression have been associated with neurodegeneration, particularly in pathways related to ALS such as axonal transport, glutamate excitotoxicity, and oxidative stress . The rs147541241:A>G missense mutation in DPYSL3 has been identified at higher frequency among French ALS patients (odds ratio = 2.99), though this association was not replicated in a Swedish population, highlighting potential geographic particularities in genetic influences .

What are the characterized protein interactions of DPYSL3?

Proteomic analyses using GST-tagged DPYSL3 affinity columns and subsequent confirmation through immunoprecipitation-western blot (IP-WB) analysis with myc-tagged DPYSL3 have revealed that DPYSL3 interacts with ezrin (EZR) . This interaction appears to be specific and functionally significant. Further investigation demonstrated that DPYSL3 participates in adhesion complexes crucial for metastatic phenotype development, as evidenced by co-immunoprecipitation of adhesion complex constituents including focal adhesion kinase (FAK), talin-1 (TLN1), and c-Src with DPYSL3 . These interactions suggest DPYSL3 may serve as a scaffold protein that facilitates the formation or stabilization of protein complexes involved in cell adhesion and migration. The functional implications of these interactions are particularly relevant in cancer metastasis and potentially in neuronal growth cone guidance, where DPYSL3's role in semaphorin/collapsin-mediated signaling has been established .

What are the key considerations when selecting a DPYSL3 antibody for research applications?

When selecting a DPYSL3 antibody for research, researchers should consider several critical factors. First, the antibody's specific binding region on DPYSL3 is important, as commercial antibodies target different epitopes including the middle region, C-terminal region, or specific amino acid sequences (e.g., AA 457-555 or AA 1-218) . Second, cross-reactivity with species of interest must be evaluated; available antibodies show predicted reactivity with human, mouse, rat, cow, dog, guinea pig, horse, and rabbit DPYSL3 with varying degrees of sequence homology . Third, clonality should be considered based on the application; both monoclonal (e.g., 1B8 clone) and polyclonal antibodies are available . Fourth, validated applications differ between antibodies, with most supporting Western blotting (WB), immunohistochemistry (IHC), and ELISA, while some are additionally validated for immunocytochemistry (ICC) . Finally, researchers should verify that adequate validation data exists for their specific application, including positive controls such as cell lysates that demonstrate specific binding .

How should researchers validate DPYSL3 antibody specificity before experimental use?

To validate DPYSL3 antibody specificity, researchers should implement a multi-step validation process. Initially, Western blotting should be performed using both positive control samples (tissues or cell lines with known DPYSL3 expression such as pancreatic cancer cell lines PANC-1 or CFPAC-1) and negative controls (tissues with minimal expression like normal pancreatic duct epithelium) . When performing Western blot validation, researchers should be aware that additional bands beyond the wild-type DPYSL3 may be detected, potentially representing modified forms of the protein . Knockdown experiments using siRNA or shRNA against DPYSL3 provide critical validation by demonstrating reduced antibody signal following DPYSL3 depletion; stable DPYSL3 knockdown can be established using lentiviral approaches with appropriate selection (e.g., puromycin at 0.5 μg/ml) . For immunohistochemical applications, comparing staining patterns between cancerous tissues (e.g., PDAC) and normal counterparts helps confirm specificity, with expected higher expression in cancerous tissues . Additionally, recombinant DPYSL3 protein can serve as a positive control, with commercial DPYSL3 antibody validation kits containing recombinant DPYSL3 (e.g., Met1~Thr218) disposed in appropriate loading buffer .

What are the optimal dilution ranges for DPYSL3 antibodies in different applications?

The optimal dilution ranges for DPYSL3 antibodies vary significantly depending on the specific application and the antibody formulation. For Western blotting applications, dilutions typically range from 1:100 to 1:400, allowing for clear visualization of the target protein while minimizing background signal . For immunocytochemistry in formalin-fixed cells, a broader range of 1:100 to 1:500 is recommended, allowing researchers to optimize for their specific cell type and fixation protocol . In immunohistochemistry applications, different protocols require different dilution ranges: for formalin-fixed frozen sections, dilutions of 1:100 to 1:500 are recommended, while paraffin-embedded sections typically require stronger antibody concentrations at 1:50 to 1:200 . For enzyme-linked immunosorbent assays (ELISA), dilutions between 1:100 and 1:200 are typically optimal . It's important to note that these ranges are guidelines, and the optimal working dilution must be determined empirically by each laboratory for their specific experimental conditions, sample types, and detection methods . When using enhanced chemiluminescent (ECL) detection in Western blotting, approximately 5μL per well is recommended, while 3,3'-Diaminobenzidine (DAB) substrate applications typically require around 10μL per well .

What are the validated methodologies for using DPYSL3 antibodies in immunoblotting experiments?

For immunoblotting experiments using DPYSL3 antibodies, researchers should follow validated methodologies beginning with proper sample preparation. Cells should be digested with 0.5% trypsinase and lysed with NP-40 lysis buffer on ice, while tissue samples should be homogenized in NP-40 lysis buffer . Protein concentration determination using commercial kits is essential for equal loading . Proteins should be fractionated through SDS/PAGE electrophoresis and transferred to PVDF membranes, followed by blocking with 5% skimmed milk . DPYSL3 antibodies should be applied at appropriate dilutions (1:100-400) and incubated for 1 hour, followed by PBST washing and incubation with appropriate secondary antibodies . Signal development using ECL solution allows visualization of DPYSL3 bands . Researchers should be prepared for the detection of additional bands beyond wild-type DPYSL3, potentially representing modified forms of the protein . For loading controls, researchers can use recombinant DPYSL3 (Met1~Thr218) disposed in loading buffer containing 100mM Tris(pH8.8), 2% SDS, 200mM NaCl, and 50% glycerol . When using enhanced chemiluminescent (ECL) detection, approximately 5μL of quality control per well is recommended .

How can DPYSL3 antibodies be effectively used in immunohistochemistry?

For effective immunohistochemistry using DPYSL3 antibodies, researchers must optimize several parameters based on the sample type. For paraffin-embedded sections, antibody dilutions ranging from 1:50 to 1:200 are recommended, while formalin-fixed frozen sections can use more dilute antibody preparations ranging from 1:100 to 1:500 . When using 3,3'-Diaminobenzidine (DAB) as the visualization substrate, approximately 10μL of antibody quality control per well is recommended . The choice between polyclonal and monoclonal antibodies depends on the specific research question, with polyclonal antibodies offering broader epitope recognition while monoclonal antibodies provide higher specificity . For validation, researchers should compare staining patterns between tissues with known differential expression of DPYSL3, such as pancreatic ductal adenocarcinoma (PDAC) tissues versus normal pancreatic duct epithelium . Based on previous studies, positive DPYSL3 staining should be observed in approximately 77.7% of PDAC tissues, while being minimal or absent in normal pancreatic duct epithelium . Appropriate controls should include both positive controls (tissues with known DPYSL3 expression) and negative controls (antibody diluent without primary antibody, or tissues known not to express DPYSL3) .

What cell-based assays can be performed to study DPYSL3 function using specific antibodies?

Several cell-based assays employing DPYSL3 antibodies can be implemented to investigate DPYSL3 function. Cell motility can be assessed through scratch wound assays, where monolayer cells are seeded in six-well culture plates for 24 hours, followed by creating a 400-600 μm width wound using a 200 μl pipette tip . After PBS washing to remove debris, cells are cultured in serum-free medium, and wound healing is observed and photographed 36 hours later, with DPYSL3 antibodies used in parallel immunoblotting to correlate protein levels with observed phenotypes . Matrigel invasion assays can also be performed following DPYSL3 manipulation (overexpression or knockdown), with subsequent analysis using DPYSL3 antibodies to confirm expression levels . For investigating DPYSL3's role in protein complexes, immunoprecipitation-western blot (IP-WB) analysis can be conducted using DPYSL3 antibodies to pull down interacting partners, as demonstrated in studies identifying interactions between DPYSL3 and adhesion complex components like EZR, FAK, TLN1, and c-Src . In neuronal contexts, axonal growth assays can be performed with cultured motor neurons expressing wild-type versus mutated DPYSL3 (e.g., rs147541241:A>G variant), using DPYSL3 antibodies to monitor protein localization and levels while assessing axonal length and cell survival .

How can researchers investigate DPYSL3 modifications and variants using antibodies?

To investigate DPYSL3 modifications and variants, researchers should implement a multi-faceted approach combining antibody-based detection with additional molecular techniques. Western blotting experiments have revealed multiple bands beyond wild-type DPYSL3, indicating potential post-translational modifications or variant forms of the protein . Researchers should use antibodies targeting different regions of DPYSL3 (N-terminal, middle region, C-terminal) to help distinguish specific variants or modified forms . For studying specific mutations such as the rs147541241:A>G missense mutation associated with ALS in French populations, researchers can generate expression vectors containing wild-type and mutant DPYSL3 for transfection into relevant cell models . Following expression, comparative immunoblotting, immunoprecipitation, and immunofluorescence using DPYSL3 antibodies can reveal differences in protein stability, interaction partners, or subcellular localization . For investigating post-translational modifications, researchers can employ phospho-specific antibodies (if available) or combine DPYSL3 immunoprecipitation with mass spectrometry to identify specific modification sites. In motor neuron models, wild-type and mutant DPYSL3 can be compared for effects on axonal growth and cell survival, with antibody staining helping to visualize protein localization and expression levels .

What are the methodologies for studying DPYSL3's role in cancer metastasis using antibodies?

To study DPYSL3's role in cancer metastasis, researchers can implement several antibody-dependent methodologies. Immunohistochemical assessment of DPYSL3 expression in primary tumors versus metastatic lesions can be performed using validated DPYSL3 antibodies at dilutions of 1:50-200 for paraffin sections, establishing correlation between expression levels and metastatic potential . For functional studies, DPYSL3 knockdown can be established in metastatic cell lines (like CFPAC-1 or NCI-H460-LNM35) using siRNA targeting specific sequences (e.g., TACATGGAGGATGGCTTAATA or CACCACCATGATCATTGACCA) . Following knockdown validation by immunoblotting with DPYSL3 antibodies, cells can be subjected to matrigel invasion assays and experimental metastasis assays in mouse models to assess metastatic capability . In vivo metastasis can be evaluated by injecting DPYSL3-manipulated cells into tail veins of mice, followed by lung metastasis quantification at defined timepoints (e.g., 48 hours post-injection) . Protein interaction studies using immunoprecipitation with DPYSL3 antibodies can identify metastasis-relevant binding partners, as demonstrated with EZR, FAK, TLN1, and c-Src . Advanced researchers might consider phosphoproteomic analysis following DPYSL3 perturbation to uncover downstream signaling effects that contribute to the metastatic phenotype, coupling this with antibody-based validation of key findings .

How can DPYSL3 antibodies be utilized to study neurodegenerative mechanisms?

DPYSL3 antibodies can be instrumental in studying neurodegenerative mechanisms through several specialized approaches. In motor neuron cultures, researchers can compare wild-type DPYSL3 with disease-associated variants such as the rs147541241:A>G missense mutation by transfecting expression constructs and using immunofluorescence with DPYSL3 antibodies to assess protein localization and expression levels . These studies can be correlated with functional readouts such as axonal growth measurements and cell survival assays, which have previously demonstrated that mutated DPYSL3 reduces axonal growth and accelerates cell death compared to wild-type protein . For investigating DPYSL3's role in ALS-associated pathways, researchers can use immunoprecipitation with DPYSL3 antibodies followed by mass spectrometry to identify interacting partners involved in axonal transport, glutamate excitotoxicity, and oxidative stress pathways . Tissue samples from neurodegenerative disease patients versus controls can be analyzed using immunohistochemistry (using antibody dilutions of 1:50-200 for paraffin sections) to assess alterations in DPYSL3 expression patterns . Advanced studies might couple DPYSL3 antibody-based detection with live imaging techniques in neuronal cultures to monitor real-time changes in protein localization during cellular stress conditions relevant to neurodegeneration .

What are common issues encountered when using DPYSL3 antibodies and how can they be resolved?

When working with DPYSL3 antibodies, researchers commonly encounter several technical challenges. Multiple band detection in Western blotting beyond the expected DPYSL3 size may represent modified forms of the protein rather than non-specific binding . To distinguish between these possibilities, researchers should perform validation experiments using DPYSL3 knockdown (with validated siRNA sequences like TACATGGAGGATGGCTTAATA or CACCACCATGATCATTGACCA) and observe which bands decrease in intensity . Insufficient signal strength can be addressed by optimizing antibody concentration (testing ranges from 1:50 to 1:500 depending on application), extending incubation times, or enhancing detection sensitivity through amplification systems . High background in immunohistochemistry applications may be reduced by extending blocking steps (using 5% skimmed milk or alternative blocking agents), optimizing antibody dilution (starting with manufacturer recommendations of 1:50-200 for paraffin sections), or modifying washing protocols . Cross-reactivity with unintended targets can be assessed through pre-adsorption tests or comparison with knockdown experiments . For applications requiring absolute specificity, researchers might consider using multiple antibodies targeting different DPYSL3 epitopes and comparing results, or switching from polyclonal to monoclonal antibodies that offer higher specificity though potentially at the cost of signal strength .

How should researchers determine optimal DPYSL3 antibody concentrations for novel experimental systems?

For determining optimal DPYSL3 antibody concentrations in novel experimental systems, researchers should implement a systematic titration approach. Begin with the manufacturer's recommended dilution ranges (1:100-400 for Western blotting, 1:100-500 for immunocytochemistry, 1:50-200 for paraffin immunohistochemistry, and 1:100-200 for ELISA) . For each application, prepare a dilution series encompassing and extending beyond these recommendations, testing at least 3-4 different concentrations. For Western blotting, use positive control samples with known DPYSL3 expression (e.g., PANC-1 or CFPAC-1 cancer cell lines) alongside negative controls . Evaluate results based on signal-to-noise ratio, with optimal concentration providing clear specific bands with minimal background. For immunohistochemistry or immunocytochemistry, perform parallel staining of positive control tissues (e.g., PDAC samples) and negative controls (normal pancreatic duct epithelium) at multiple antibody dilutions . The optimal concentration should provide clear cellular localization patterns in positive samples with minimal background in negative controls. Consider that different detection systems (fluorescent vs. chromogenic) may require different antibody concentrations. For novel cell lines or tissues, researchers should verify DPYSL3 expression at the mRNA level before antibody optimization to ensure the target protein is present. Finally, validation through DPYSL3 knockdown experiments provides the strongest confirmation of antibody specificity at the selected concentration .