DRAM1 Antibody

What is DRAM1 and why is it important in cellular research?

DRAM1 is an evolutionarily conserved transmembrane protein that predominantly localizes to lysosomes and functions as a stress-inducible regulator of autophagy and cell death. It has been implicated in cancer, myocardial infarction, and infectious diseases, making it a significant target for various research areas . DRAM1 acts at the crossroad of autophagy and cell death pathways, serving as a target of TP53-mediated autophagy . Understanding DRAM1's functions provides insights into fundamental cellular processes and disease mechanisms.

What are the primary cellular localizations of DRAM1?

DRAM1 is a transmembrane protein with complex subcellular distribution. Research has demonstrated that:

• DRAM1 predominantly localizes to lysosomes

• DRAM1 isoforms are partly localized to peroxisomes, autophagosomes, and endoplasmic reticulum

• DRAM1 has been observed to localize in a punctate pattern around mycobacteria shortly after phagocytosis, which gradually progresses to full DRAM1 envelopment of the bacteria

• DRAM1 may also be involved in maintaining normal organization of the Golgi apparatus

These diverse localizations reflect DRAM1's multifunctional roles in cellular processes.

What are the recommended fixation protocols for DRAM1 immunostaining?

For optimal DRAM1 immunostaining, consider these methodological approaches:

• Paraformaldehyde fixation (4%) for 15-20 minutes at room temperature preserves DRAM1 membrane structure while maintaining antibody accessibility

• For co-localization studies with autophagy markers like LC3, avoid methanol fixation as it can disrupt membrane structures where DRAM1 resides

• When studying DRAM1 in mycobacterial infection models, fixation should be performed after infection time points to capture dynamic localization changes

• For tissues, prepare 5-10 μm sections and use antigen retrieval methods to enhance detection sensitivity

Validation using multiple antibody clones is recommended to confirm staining patterns, as DRAM1's transmembrane nature can make epitope accessibility challenging.

What are the optimal conditions for using DRAM1 antibodies in Western blot analysis?

For DRAM1 detection, researchers should be aware that multiple bands may appear due to post-translational modifications or isoforms. Verification with knockdown controls is essential to confirm specificity .

How can researchers effectively perform DRAM1 immunofluorescence microscopy?

To achieve optimal DRAM1 immunofluorescence results:

• Seed cells on glass coverslips at 50-70% confluence to allow visualization of individual cells

• Fix with 4% paraformaldehyde for 15-20 minutes at room temperature

• Permeabilize with 0.1-0.2% Triton X-100 for 5-10 minutes

• Block with 5% BSA or normal serum for 1 hour at room temperature

• Incubate with primary DRAM1 antibody (1:100-1:200 dilution) overnight at 4°C

• Apply fluorescently-labeled secondary antibody (1:500-1:1000) for 1 hour at room temperature

• For co-localization studies, use established markers such as:

  • LAMP1 for lysosomes

  • LC3 for autophagosomes

  • LysoTracker for acidic compartments

For analyzing DRAM1's role in autophagy, researchers have used this approach to demonstrate decreased distribution of LC3II and increased expression of p62 in the cytoplasm after DRAM1 knockdown .

What controls should be included when validating DRAM1 antibody specificity?

Proper validation of DRAM1 antibodies requires multiple controls:

• Positive Controls: Use cell lines with known DRAM1 expression (e.g., HEK293T, A549, NCI-H1975, PC9 cells)

• Negative Controls: Include:

  • Omission of primary antibody

  • Isotype-matched control antibody

  • DRAM1 knockdown cells using validated siRNA or shRNA constructs (e.g., sh-DRAM1: CCTACAGTCCATCATCTCTTA)

• Western Blot Validation: Confirm antibody recognizes a band of expected molecular weight (~27 kDa)

• Cross-validation: Use multiple antibodies targeting different DRAM1 epitopes

• Functional Validation: Verify DRAM1 localization changes under conditions known to affect its distribution (e.g., during autophagy induction or mycobacterial infection)

Researchers have demonstrated effective DRAM1 knockdown of 57-71% using specific siRNAs, which can serve as controls for antibody specificity testing .

How can DRAM1 antibodies be used to study mycobacterial infections?

DRAM1 antibodies are valuable tools for investigating host-pathogen interactions in mycobacterial infections:

• Tracking DRAM1 recruitment to mycobacteria:

  • Use fluorescently-tagged DRAM1 antibodies to visualize DRAM1 localization to Mycobacterium-containing vesicles

  • Observe the progression from punctate pattern to full DRAM1 envelopment of bacteria

• Co-localization studies:

  • Combine DRAM1 antibodies with markers for autophagosomes (LC3) and lysosomes (LysoTracker, LAMP1)

  • This approach has revealed that DRAM1-positive mycobacteria colocalize with these markers within the same timeframe

• Vesicle acidification analysis:

  • Use DRAM1 antibodies alongside pH-sensitive dyes to study acidification of bacteria-containing compartments

  • Research has shown that DRAM1 deficiency leads to reduced acidification of mycobacteria-containing vesicles

• Functional studies in infection models:

  • Compare wild-type and DRAM1-deficient cells/organisms to assess bacterial containment

  • In zebrafish models, DRAM1 mutation increased susceptibility to Mycobacterium marinum infection

These approaches have revealed that DRAM1 promotes trafficking of mycobacteria through the degradative (auto)phagolysosomal pathway, making it a promising target for therapeutic modulation of macrophage microbicidal capacity .

What methodological approaches are recommended for studying DRAM1's function in autophagy during infectious disease?

To investigate DRAM1's role in infection-related autophagy:

• Gene manipulation strategies:

  • Generate dram1 mutant organisms (e.g., zebrafish) to study loss-of-function effects

  • Use lentiviral vector-mediated DRAM1-FLAG overexpression constructs or shRNAs for gain/loss-of-function studies

• Infection models:

  • In vitro: Infect macrophage cell lines (e.g., RAW264.7) with mycobacteria and track bacterial survival

  • In vivo: Use zebrafish larvae infected with Mycobacterium marinum as a TB research model

• Autophagy assessment techniques:

  • Monitor LC3-I to LC3-II conversion via western blot

  • Track p62 degradation as an indicator of autophagic flux

  • Use fluorescence microscopy to visualize autophagic vacuoles

• Functional readouts:

  • Measure bacterial survival/growth in DRAM1-deficient vs. control cells

  • Assess macrophage survival during infection

  • Analyze inflammatory responses (e.g., pyroptosis markers like caspase a and gasdermin Eb)

Research has shown that DRAM1 deficiency leads to reduced autophagic targeting of mycobacteria, reduced acidification of bacteria-containing vesicles, and premature cell death of infected macrophages through pyroptosis .

How can DRAM1 antibodies help evaluate DRAM1's role as a tumor suppressor?

DRAM1 has shown tumor suppressor functions in several cancer types, and antibodies can be used to investigate these mechanisms:

• Expression analysis in clinical samples:

  • Use immunohistochemistry to compare DRAM1 expression between tumor and adjacent normal tissues

  • Studies have shown decreased DRAM1 expression in NSCLC associated with poor prognosis

• Correlation with clinical outcomes:

  • Develop tissue microarrays with patient samples and correlate DRAM1 expression with survival data

  • Quantify staining intensity using image analysis software for objective assessment

• Mechanistic studies:

  • Investigate DRAM1's interaction with tumor-promoting pathways

  • Research has shown DRAM1 increases EGFR endocytosis and lysosomal degradation in NSCLC, downregulating EGFR signaling

• Functional validation:

  • Use immunoblotting to confirm DRAM1 overexpression or knockdown in experimental models

  • Correlate with functional assays (proliferation, migration, invasion)

  • In vivo xenograft studies have shown that DRAM1 overexpression suppresses NSCLC tumor growth

These approaches can reveal how DRAM1 functions as a tumor suppressor in different cancer types and contexts.

What methods should be used to investigate DRAM1's effects on cancer cell migration and invasion?

To study DRAM1's impact on cancer cell metastatic properties:

• Transwell migration and invasion assays:

  • Manipulate DRAM1 expression using overexpression constructs or siRNA/shRNA

  • Use Transwell chambers with or without Matrigel coating to assess invasion and migration capabilities

  • Studies have shown that DRAM1 knockdown reduced the number of migrated and invaded HepG2 cells

• In vivo metastasis models:

  • Inject DRAM1-manipulated cancer cells (e.g., 1×10^7 cells) into nude mice via tail vein

  • Monitor metastatic growth over time (e.g., 4 weeks)

  • Research has demonstrated that DRAM1 knockdown cells exhibited slower growth and lower metastasis compared to control cells

• Epithelial-mesenchymal transition (EMT) assessment:

  • Use western blotting and immunofluorescence to detect EMT markers

  • Research has shown DRAM1 knockdown increased E-Cadherin expression while decreasing vimentin in HepG2 cells

• Autophagy-EMT pathway analysis:

  • Use autophagy inducers (e.g., rapamycin) to determine if they can reverse migration/invasion defects in DRAM1-deficient cells

  • Studies have demonstrated that rapamycin treatment reversed the inhibition of migration and invasion in DRAM1 knockdown cells

These methods have revealed that DRAM1 is involved in regulating migration and invasion of cancer cells via the autophagy-EMT pathway .

What techniques are available for studying DRAM1 interactions with other proteins?

Several sophisticated approaches can be used to investigate DRAM1's protein interactions:

• Co-immunoprecipitation (Co-IP):

  • Use DRAM1 antibodies to pull down DRAM1 and its interacting partners

  • Western blot for suspected interacting proteins

  • Research has shown DRAM1 interacts with EPS15 to promote EGFR endocytosis

• Proximity labeling followed by proteomics:

  • Fuse DRAM1 to proximity labeling enzymes (BioID or APEX)

  • Label proteins in close proximity to DRAM1 in living cells

  • Identify labeled proteins by mass spectrometry

  • This approach has identified DRAM1's interaction with EPS15

• Fluorescence resonance energy transfer (FRET):

  • Tag DRAM1 and potential interacting partners with appropriate fluorophores

  • Measure energy transfer as indication of protein proximity

• Bimolecular fluorescence complementation (BiFC):

  • Split a fluorescent protein and fuse halves to DRAM1 and potential interacting partners

  • Reconstitution of fluorescence indicates protein interaction

• Yeast two-hybrid screening:

  • Use DRAM1 as bait to screen for interacting proteins from cDNA libraries

Research has shown that DRAM1 interacts with ATG7 in acute myocardial infarction, enhancing the conversion of autophagosomes to autophagolysosomes . Additionally, DRAM1 recruits V-ATP6V1 subunit to lysosomes, increasing the assembly of the V-ATPase complex .

How can researchers study DRAM1's role in lysosomal function and acidification?

DRAM1's involvement in lysosomal function can be investigated through these methodological approaches:

• Lysosomal pH measurement:

  • Use ratiometric pH-sensitive dyes (e.g., LysoSensor Yellow/Blue)

  • Apply pH-sensitive fluorescent proteins targeted to lysosomes

  • Research has shown DRAM1 augments lysosomal acidification by recruiting the V-ATP6V1 subunit

• Lysosomal enzyme activity assays:

  • Measure activities of cathepsins and other lysosomal hydrolases

  • Use fluorogenic substrates that become fluorescent upon cleavage by lysosomal enzymes

  • DRAM1 has been shown to promote increased activation of lysosomal proteases

• Lysosomal fusion assays:

  • Track fusion events between lysosomes and autophagosomes or phagosomes

  • Use fluorescently labeled organelles and live-cell imaging

  • DRAM1 enhances the fusion between autophagosomes and lysosomes

• V-ATPase assembly analysis:

  • Perform subcellular fractionation to isolate lysosomes

  • Analyze V-ATPase complex assembly by western blotting

  • Use co-immunoprecipitation to detect interactions between DRAM1 and V-ATPase components

  • DRAM1 recruits the V-ATP6V1 subunit to lysosomes, increasing V-ATPase complex assembly

These methods have revealed that DRAM1 plays a critical role in promoting lysosomal acidification, which is essential for its functions in autophagy, bacterial clearance, and tumor suppression.

What approaches can help resolve contradictory data regarding DRAM1 function in different experimental models?

Researchers facing contradictory results regarding DRAM1 function should consider:

• Context-dependent analysis:

  • DRAM1 shows tissue-specific effects - upregulated in intestinal inflammation (IBD) but decreased in NSCLC

  • Compare expression patterns across different disease models and cell types

• Isoform-specific investigation:

  • Design experiments to distinguish between DRAM1 isoforms

  • Use isoform-specific antibodies or primers

  • Different isoforms localize to different subcellular compartments

• Pathway mapping:

  • Examine upstream regulators and downstream effectors in each model

  • DRAM1 interacts with JNK pathway in intestinal inflammation

  • DRAM1 affects EGFR trafficking in NSCLC

  • Different pathways may explain seemingly contradictory results

• Temporal analysis:

  • Assess DRAM1 function at different time points during disease progression

  • Initial protective responses may differ from later pathological effects

• In vivo validation:

  • Confirm in vitro findings in appropriate animal models

  • DRAM1 knockdown alleviates colitis in mice but increases susceptibility to mycobacterial infection

This comprehensive approach can help reconcile apparently contradictory findings by recognizing that DRAM1's function may vary depending on cellular context, timing, and interacting pathways.