DTL Antibody

What is DTL and why is it significant in research?

DTL (denticleless E3 ubiquitin protein ligase homolog) is a substrate-specific adapter of the DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complex that plays critical roles in cell cycle control, DNA damage response, and translesion DNA synthesis. In humans, the canonical form consists of 730 amino acid residues with a molecular mass of approximately 79.5 kDa . DTL is also known by several synonyms including DCAF2, L2DTL, RAMP, denticleless protein homolog, DDB1- and CUL4-associated factor 2, and CDT2 . The protein contains characteristic WD40 repeat domains and localizes to the membrane, nucleus, and cytoplasm . DTL has gained significant research interest due to its involvement in multiple cancers and potential value as a diagnostic and prognostic biomarker .

What applications are DTL antibodies most commonly used for?

DTL antibodies are utilized for multiple research applications, with the most common being:

• Western Blotting (WB): For detecting DTL protein expression levels in cell and tissue lysates

• Immunohistochemistry (IHC): For visualizing DTL expression patterns in tissue sections

• Immunoprecipitation (IP): For isolating DTL protein complexes and studying protein-protein interactions

• Immunofluorescence (IF): For subcellular localization studies

• Flow Cytometry (FCM): For quantitative analysis of DTL expression in cell populations

• ELISA: For quantitative measurement of DTL levels

The selection of appropriate antibody depends on the specific application, with different suppliers offering antibodies validated for different techniques. For complex experiments involving multiple detection methods, researchers should select antibodies validated across all required applications.

How should researchers validate DTL antibodies before experimental use?

When validating DTL antibodies, researchers should follow these methodological steps:

• Positive and negative controls: Use cell lines with known DTL expression levels (high in placenta and testis tissues) versus low-expression tissues (skeletal muscle) .

• Knockdown/knockout validation: Implement DTL knockdown using validated shRNA sequences (e.g., GCCTAGTAACAGTAACGAGTA, CTGGTGAACTTAAACTTGTTA, or GCTCCCAATATGGAACATGTA) to confirm antibody specificity.

• Western blot analysis: Verify single band detection at the expected molecular weight (79.5 kDa) .

• Cross-reactivity assessment: If working with non-human models, confirm reactivity with the species of interest, as DTL orthologs exist in mouse, rat, bovine, frog, zebrafish, chimpanzee, and chicken species .

• Application-specific validation: For IHC applications, include known positive tissues and optimize staining parameters using the staining index (SI) calculation: SI = positive staining score (0-4 points) × staining intensity score (0-3 points) .

How can researchers effectively use DTL antibodies to study its role in cancer progression?

To investigate DTL's role in cancer progression, researchers should implement a multi-faceted approach:

• Comparative expression analysis: Use DTL antibodies for IHC or IF to quantify expression levels across normal tissues, primary tumors, and metastatic samples. Implement the scoring system where the staining index (SI) is calculated by multiplying the positive staining score (percentage of positive cells on a 0-4 scale) by the staining intensity score (0-3 scale) .

• Correlation with clinical parameters: Analyze DTL expression in relation to clinical features such as tumor stage, grade, and patient outcomes. Divide samples into high and low DTL expression groups based on median SI scores (e.g., median of 10 points) for statistical analyses .

• Co-localization studies: Use dual immunofluorescence to assess DTL co-localization with other cancer-related proteins. For example, examining the relationship between DTL expression and immune cell infiltration markers like CD3 can provide insights into the tumor microenvironment .

• Functional validation: Implement DTL overexpression or knockdown in cell lines, followed by cell proliferation assays (e.g., BrdU incorporation), cell cycle analysis, and genomic stability assessments to determine the functional consequences of altered DTL expression .

• Downstream signaling analysis: Use DTL antibodies in combination with antibodies against known interacting partners (e.g., PDCD4, RUVBL1) to elucidate the molecular mechanisms through which DTL promotes cancer progression .

What methodologies are optimal for studying DTL-mediated protein ubiquitination?

To effectively study DTL-mediated protein ubiquitination, researchers should follow these methodological approaches:

• Co-immunoprecipitation (Co-IP) assays: Use DTL antibodies to pull down protein complexes, followed by immunoblotting for potential target proteins. This approach has successfully identified interactions between DTL and proteins like PDCD4 .

• Affinity-purification mass spectrometry: This comprehensive approach can identify novel DTL interaction partners. Transfect cells with Flag-DTL plasmid, immunoprecipitate using Flag magnetic affinity resin, separate by SDS-PAGE, and analyze excised bands by mass spectrometry .

• Ubiquitination assays: To detect ubiquitination of target proteins:

  • Co-transfect cells with plasmids expressing DTL and the target protein

  • Treat cells with proteasome inhibitors (e.g., MG132) to prevent degradation of ubiquitinated proteins

  • Immunoprecipitate the target protein and immunoblot with anti-ubiquitin antibodies

  • Alternatively, use ubiquitin mutants (K48R or K63R) to distinguish between different ubiquitination types

• Domain mapping experiments: Generate truncated fragments of DTL (e.g., constructs containing only the WD40 domains) to identify regions responsible for target protein interactions. This approach revealed that the WD40 domains (amino acids 35-398) are essential for DTL's interaction with PDCD4 .

• In vitro ubiquitination assays: Reconstitute the ubiquitination reaction using purified components (E1, E2, DTL-containing E3 complex, ubiquitin, and substrate) to directly demonstrate DTL-mediated ubiquitination.

How can researchers investigate the relationship between DTL and DNA damage response pathways?

To investigate DTL's role in DNA damage response (DDR) pathways, researchers should employ these methodological approaches:

• Radiation-induced damage models: Expose cells to radiation treatment and analyze changes in DTL expression and localization using DTL antibodies. This approach revealed that RUVBL1 ubiquitination by DTL promotes the formation of RUVBL1/2-β-catenin transcription complexes following radiation treatment .

• Co-localization with DDR markers: Perform immunofluorescence to assess co-localization of DTL with DNA damage markers (γH2AX) and repair proteins at different time points after damage induction.

• Chromatin immunoprecipitation (ChIP): Use DTL antibodies for ChIP assays to determine if DTL associates with chromatin at damaged sites.

• Protein complex analysis: Implement immunoprecipitation with DTL antibodies followed by mass spectrometry to identify DDR-related interaction partners under normal and damage-induced conditions.

• Functional assays: Assess the impact of DTL knockdown or overexpression on:

  • H4K16 acetylation-mediated homologous recombination (HR) repair

  • Non-homologous end joining (NHEJ) repair pathway proteins

  • Genomic stability (using chromosome slide preparation techniques)

• Cell cycle checkpoint analysis: Use flow cytometry with DTL antibodies to analyze the role of DTL in radiation-induced G2/M checkpoint activation, as DTL has been identified as an essential component of this checkpoint .

What are optimal conditions for using DTL antibodies in Western blotting applications?

For optimal Western blotting with DTL antibodies, researchers should follow these methodological recommendations:

• Sample preparation:

  • Extract total proteins using T-PER buffer with protease and phosphatase inhibitors

  • Determine protein concentration using BCA Protein Assay

  • Use equal amounts of protein (typically 20-50 μg)

  • Reduce samples with 10 mM dithiothreitol

  • Alkylate with 50 mM iodoacetamide (IAA) in the dark

• Gel electrophoresis:

  • Use 8-10% SDS-PAGE gels to achieve good separation around the 79.5 kDa range where DTL migrates

  • Include positive control samples (placenta or testis extracts)

• Transfer and blocking:

  • Transfer to PVDF membrane at 100V for 90 minutes in cold transfer buffer

  • Block with 5% non-fat milk in TBST for 1 hour at room temperature

• Antibody incubation:

  • Primary antibody dilution: 1:1000 to 1:2000 (optimize based on specific antibody)

  • Incubate overnight at 4°C

  • Wash 3x with TBST

  • Secondary antibody: Use HRP-conjugated antibody at 1:5000 dilution for 1 hour at room temperature

• Detection:

  • Use ECL reagent for visualization

  • Expected band size: 79.5 kDa

• Troubleshooting:

  • If detecting multiple bands, increase washing stringency and optimize antibody dilution

  • If signal is weak, increase protein loading or antibody concentration

  • For low abundance in certain tissues, consider immunoprecipitation before Western blotting

What controls should be included when studying DTL function through knockdown or overexpression?

When manipulating DTL expression levels, include these controls to ensure experimental validity:

• Knockdown controls:

  • Non-targeting shRNA/siRNA control

  • Multiple DTL-targeting shRNA sequences to control for off-target effects (recommended sequences: GCCTAGTAACAGTAACGAGTA, CTGGTGAACTTAAACTTGTTA, GCTCCCAATATGGAACATGTA)

  • Rescue experiments with shRNA-resistant DTL constructs

  • qRT-PCR and Western blot validation of knockdown efficiency

• Overexpression controls:

  • Empty vector control

  • Wild-type Flag-DTL plasmid

  • Domain-specific mutants (e.g., WD40 domain mutants)

  • Verification of expression by Western blot

  • Both transient and stable expression systems to control for adaptation effects

• Functional controls:

  • Cell cycle analysis using BrdU incorporation (10 μM/ml BrdU for 25 min before harvest)

  • DNA damage assessment before and after manipulation

  • Cell proliferation assays with appropriate time points

  • Genomic stability assessments through chromosome slide preparation

• Pathway validation:

  • Analysis of known DTL targets (CDT1, Set8, p21) to confirm pathway functionality

  • Assessment of ubiquitination status of interaction partners (PDCD4, RUVBL1)

How can researchers effectively detect and quantify DTL expression in tissue samples?

For accurate detection and quantification of DTL in tissue samples, researchers should:

• Immunohistochemistry (IHC) protocol:

  • Use paraffin-embedded or frozen tissue sections (5-7 μm thickness)

  • Perform antigen retrieval in citrate buffer (pH 6.0)

  • Block endogenous peroxidase with 3% H₂O₂

  • Block with 5% BSA or serum

  • Incubate with anti-DTL primary antibody overnight at 4°C

  • Implement a standardized scoring system where:

    • Positive staining score: 0 (0-5%), 1 (5-25%), 2 (26-50%), 3 (51-75%), 4 (>75%)

    • Staining intensity score: 0 (no staining), 1 (weak/light yellow), 2 (moderate/bright yellow), 3 (strong/brown)

    • Staining index (SI) = positive staining score × intensity score

    • Categorize as high or low DTL expression based on median SI value (e.g., 10 points)

• Immunofluorescence (IF) for co-localization studies:

  • After staining with primary antibodies (e.g., anti-DTL and anti-CD3)

  • Incubate with appropriate secondary antibodies (anti-rabbit-Cy3 for DTL, anti-mouse-FITC for CD3)

  • Counterstain nuclei with DAPI

  • Capture images using fluorescence microscopy

  • Quantify percentage of positive cells and analyze relationship between DTL expression and other markers

• Tissue microarray (TMA) analysis:

  • For high-throughput analysis of multiple samples

  • Ensure inclusion of normal tissue controls

  • Apply the standardized scoring system described above

  • Use digital pathology software for automated quantification when possible

How should researchers analyze the relationship between DTL expression and clinical outcomes?

To properly analyze associations between DTL expression and clinical outcomes, researchers should follow these methodological approaches:

What approaches should be used to study DTL's role in tumor immunology?

To investigate DTL's role in tumor immunology, researchers should employ these methodological approaches:

• Immune infiltration analysis:

  • Perform multiplex immunofluorescence staining for DTL and immune cell markers (e.g., CD3 for T cells)

  • Quantify immune cell populations in high vs. low DTL-expressing regions

  • Analyze the relationship between DTL expression and the percentage of CD3-positive cells by dividing samples into high and low CD3 groups according to median values (e.g., 10%)

• Immunotherapy response prediction:

  • Analyze DTL expression in pre-treatment biopsies from immunotherapy responders vs. non-responders

  • Utilize datasets containing DTL transcriptomic and genomic profiling with immunotherapy outcomes (e.g., GEO: GSE78220, GEO: GSE67501, IMvigor210)

  • Compare DTL expression between responders and non-responders to checkpoint blockade (anti-PDL1, anti-PD1)

• In vitro immune interaction models:

  • Co-culture tumor cells with varying DTL expression levels with immune cells

  • Assess changes in immune activation markers and cytokine production

  • Evaluate the effect of DTL knockdown or overexpression on immune cell recruitment and function

• Pathway analysis:

  • Investigate correlations between DTL expression and immune-related signaling pathways

  • Use GSEA to identify immune pathways associated with DTL expression levels

  • Analyze the relationship between DTL-mediated ubiquitination and immune response modulation

How can researchers address data inconsistencies in DTL expression studies?

When facing inconsistent results in DTL research, implement these methodological approaches:

• Antibody validation and standardization:

  • Verify antibody specificity through knockdown/knockout controls

  • Compare multiple commercial antibodies for consistency

  • Use the same antibody lot number throughout a study

  • Include positive control samples with known DTL expression

• Experimental design considerations:

  • Control for cell confluence and passage number in cell line studies

  • Standardize tissue collection, processing, and storage protocols

  • Implement blinded scoring in IHC/IF studies

  • Use technical and biological replicates

• Context-specific expression analysis:

  • Account for tumor heterogeneity by analyzing multiple regions

  • Consider microenvironmental factors that might influence DTL expression

  • Analyze DTL expression in relation to cell cycle phase

  • Evaluate post-translational modifications that might affect antibody recognition

• Statistical approaches:

  • Perform power calculations to ensure adequate sample size

  • Use appropriate statistical tests based on data distribution

  • Implement multiple testing corrections

  • Report effect sizes alongside p-values

  • Consider Bayesian approaches for integrating conflicting data

What emerging technologies could advance DTL research?

Researchers should consider these emerging technologies to enhance DTL research:

• Single-cell analysis:

  • Single-cell proteomics to analyze DTL expression heterogeneity within tumors

  • Single-cell RNA-seq combined with protein expression (CITE-seq) to correlate DTL transcription and translation

  • Spatial transcriptomics to map DTL expression within the tumor microenvironment

• Advanced imaging techniques:

  • Super-resolution microscopy for detailed subcellular localization

  • Live-cell imaging with fluorescently tagged DTL to track dynamics during cell cycle and DNA damage

  • Multiplexed ion beam imaging (MIBI) or cyclic immunofluorescence for simultaneous detection of multiple markers

• Protein interaction mapping:

  • Proximity labeling techniques (BioID, APEX) to identify the DTL interactome in living cells

  • Hydrogen-deuterium exchange mass spectrometry (HDX-MS) to map protein interaction domains

  • Cryo-electron microscopy to determine 3D structures of DTL-containing complexes

• Functional genomics:

  • CRISPR-Cas9 screens to identify synthetic lethal interactions with DTL

  • CRISPR base editing to introduce specific mutations in DTL domains

  • Degron tagging for acute depletion of DTL protein

What are the current challenges in developing highly specific DTL antibodies?

Researchers face several challenges in developing specific DTL antibodies:

• Structural complexity:

  • The presence of highly conserved WD40 domains makes it difficult to generate antibodies specific to DTL versus other WD40-containing proteins

  • Two different isoforms of DTL have been reported, requiring isoform-specific antibodies for certain applications

• Post-translational modifications:

  • DTL undergoes ubiquitination and phosphorylation, which may affect epitope accessibility

  • Modification-specific antibodies might be needed to track DTL functional states

• Cross-reactivity concerns:

  • High sequence conservation among DTL orthologs in different species makes it challenging to develop species-specific antibodies

  • Thorough validation is required when using antibodies across species

• Technical limitations:

  • The subcellular localization of DTL in membrane, nucleus, and cytoplasm requires antibodies that work in multiple cellular compartments

  • Different fixation methods may affect epitope preservation and antibody performance

What are promising therapeutic applications stemming from DTL antibody research?

DTL antibody research is revealing several promising therapeutic directions:

• Cancer diagnostics and prognostics:

  • Development of DTL-based biomarker panels for cancer diagnosis

  • Prognostic assays based on DTL expression levels in different cancer types

  • Predictive tests for radiotherapy response based on DTL expression

• Targeted therapy approaches:

  • Small molecule inhibitors targeting the DTL-containing E3 ubiquitin ligase complex

  • Degrader technologies (PROTACs) targeting DTL for degradation

  • Disruption of specific interactions (e.g., DTL-RUVBL1) to sensitize cancer cells to radiation therapy

• Immunotherapy enhancement:

  • Strategies to modulate DTL expression to improve immunotherapy response

  • Combination approaches targeting DTL pathways alongside immune checkpoint inhibitors

  • Development of DTL expression profiles to guide immunotherapy selection

• Radiotherapy sensitization:

  • Targeting the DTL-RUVBL1/2-β-catenin axis to overcome radioresistance in breast cancer

  • Development of adjuvant therapies that modulate DTL activity during radiation treatment

  • Personalized radiation protocols based on tumor DTL expression levels

Through continued research using high-quality DTL antibodies, these therapeutic applications may translate into clinically meaningful advances for cancer patients.