EHHADH is a peroxisomal trifunctional enzyme possessing 2-enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase, and delta 3, delta 2-enoyl-CoA isomerase activities. It catalyzes two of the four reactions in the long-chain fatty acids peroxisomal beta-oxidation pathway. The enzyme plays a critical role in energy production by breaking down long-chain fatty acids and regulating fatty acid oxidation pathways. EHHADH can also metabolize branched-chain fatty acids such as 2-methyl-2E-butenoyl-CoA, which is hydrated into (2S,3S)-3-hydroxy-2-methylbutanoyl-CoA. Additionally, it serves as an optimal isomerase for 2,5 double bonds into 3,5 form isomerization in various enoyl-CoA species . Recent research has also demonstrated that EHHADH is essential for DHA synthesis in the "Sprecher" pathway, highlighting its importance in polyunsaturated fatty acid metabolism .
EHHADH holds significant importance in metabolic research due to its integral role in energy metabolism and fatty acid oxidation. Bioinformatics analyses position EHHADH in processes that generate energy from fatty acids. As a PPAR-inducible gene, EHHADH becomes particularly crucial during fasting conditions when fatty acid metabolism is upregulated. Research has demonstrated that EHHADH is essential for the formation of medium-chain dicarboxylic acids (DCAs) such as C6-DCA, which regulate all fatty acid oxidation pathways . Furthermore, EHHADH expression shows a significant negative correlation with fasting plasma glucose in certain mouse populations, suggesting its involvement in glucose metabolism through its effects on energy generation from fatty acids . Recent studies have also revealed EHHADH's role in DHA synthesis, with EHHADH deletion reducing DHA content and inhibiting the synthesis of n-3 polyunsaturated fatty acids (PUFAs), while overexpression promotes DHA synthesis .
EHHADH antibodies have been validated for multiple experimental techniques crucial for metabolic research. Based on the available research resources, EHHADH antibodies are primarily suitable for Western blot (WB) applications, with demonstrated efficacy in detecting the protein in various human cell lines including HeLa, 293T, and Jurkat cells . Additionally, these antibodies have been validated for immunoprecipitation (IP) procedures, allowing researchers to isolate and study EHHADH protein complexes and interactions . The antibodies show specificity toward human EHHADH samples, which makes them valuable tools for studies involving human cell lines and tissues. While not explicitly mentioned in the search results, based on general antibody applications, EHHADH antibodies might potentially be useful for immunohistochemistry, ELISA, or flow cytometry after proper validation. Researchers should consult specific product documentation for validated applications beyond WB and IP.
When using EHHADH antibodies for Western blot applications, researchers should expect to detect a protein band at approximately 79 kDa, which corresponds to the predicted molecular weight of EHHADH . Western blot experiments using the ab123490 EHHADH antibody have successfully detected the protein in multiple human cell lines. Specifically, this antibody has been tested at a concentration of 0.4 μg/mL with HeLa whole cell lysates (at both 50 μg and 15 μg loading amounts), 293T whole cell lysate (50 μg), and Jurkat whole cell lysate (50 μg) . For optimal results, researchers should use the ECL detection technique, with an exposure time of approximately 3 minutes being sufficient for visualization. The antibody demonstrates good sensitivity, as it can detect EHHADH even when only 15 μg of total protein lysate is loaded (as shown with HeLa cells), making it suitable for experiments where sample quantity may be limited .
For effective immunoprecipitation (IP) studies of EHHADH, researchers should use approximately 6 μg of antibody per mg of cell lysate, as demonstrated in successful IP experiments with 293T cell lysates. The standard protocol involves using 1 mg of total cell lysate for IP, followed by loading about 20% of the immunoprecipitated material for subsequent Western blot detection . For detection following IP, a lower concentration of antibody (approximately 1 μg/ml) is typically sufficient for Western blot analysis of the immunoprecipitated material. It's advisable to include appropriate controls in IP experiments, such as control IgG immunoprecipitations, to verify the specificity of the interaction. In comparative studies, researchers may also consider using antibodies that recognize different epitopes of EHHADH; for instance, an antibody recognizing an upstream epitope of EHHADH can be used for IP, while another antibody like ab123490 can be used for detection . This dual-antibody approach can enhance the specificity of results and provide more robust experimental data.
Designing experiments to study EHHADH function in metabolic pathways requires a multifaceted approach. First, researchers should consider gene expression manipulation techniques such as CRISPR/Cas9 for knockout models or plasmid-based overexpression systems, as demonstrated in zebrafish models . For EHHADH knockout, targeting exons is effective - the second exon was successfully targeted in zebrafish studies with the sequence GTGGAGAGAATGGGCGATTCTG . When overexpressing EHHADH, using pTol2-MCS-EGFP fusion plasmids containing P-CMV segments and EGFP for tracking expression has proven successful .
For metabolic analysis, researchers should design experiments that include fasting conditions, as EHHADH's role becomes more prominent during periods of energy deficit . Additionally, comparing wild-type and EHHADH-modified organisms under different dietary conditions (e.g., linseed oil vs. fish oil diets in zebrafish studies) can reveal functional aspects of EHHADH in fatty acid metabolism and DHA synthesis . Experimental readouts should include measurements of fatty acid profiles, particularly focusing on medium-chain dicarboxylic acids and polyunsaturated fatty acids like DHA. Incorporating transcriptomic analysis can also provide insights into regulatory mechanisms, with particular attention to genes involved in PUFA synthesis and fatty acid oxidation pathways .
When working with EHHADH antibodies, implementing appropriate controls is essential for result validation and interpretation. For Western blot applications, positive controls should include cell lines with confirmed EHHADH expression, such as HeLa, 293T, or Jurkat cells, which have been validated to express detectable levels of EHHADH . Loading controls like β-actin or GAPDH should be included to normalize protein loading across samples. For immunoprecipitation experiments, include a control IgG precipitation from the same lysate to assess non-specific binding .
When designing knockout or knockdown studies, include wild-type controls alongside heterozygous and homozygous knockout samples to establish a phenotypic gradient. In genetic variation studies, incorporating multiple inbred strains (as demonstrated with C57BL/6, BTBR, DBA, and C3H strains) can provide insights into how genetic background influences EHHADH expression and function . When studying EHHADH in metabolic contexts, include both fed and fasted conditions, as EHHADH's role becomes particularly crucial during fasting . For qRT-PCR validation of EHHADH expression, use established housekeeping genes like β-actin as reference controls for normalization, and implement the 2^(-ΔΔCT) method for relative quantification . These comprehensive controls ensure robust and reproducible results when studying EHHADH using antibody-based approaches.
Investigating EHHADH interactions with other proteins in peroxisomal fatty acid metabolism requires sophisticated molecular approaches. Co-immunoprecipitation (Co-IP) experiments using EHHADH antibodies can effectively capture protein complexes for subsequent analysis. Researchers should target known interacting partners such as HSD17B4, with which EHHADH collaborates to catalyze the hydration of trans-2-enoyl-CoA and the dehydrogenation of 3-hydroxyacyl-CoA, albeit with opposite chiral specificity . Western blot analysis following Co-IP should utilize antibodies against suspected interacting partners like Cyp4a10, Acox1, HSD17B4, and Abcd3 (PMP70) .
For systems-level analysis, researchers can employ bioinformatics approaches to construct coexpression networks, as demonstrated in studies using liver expression data from various mouse crosses (C57BL/6 x BTBR, C57BL/6 x DBA/2J, and C57BL/6J x C3H/HeJ) . These networks can reveal functional associations between EHHADH and other metabolic genes. The cytoscape platform with plug-ins like Bingo (Biological Networks Gene Ontology tool) can help identify significantly overrepresented GO terms in sets of EHHADH correlates . Additionally, proximity ligation assays can visualize protein-protein interactions in situ, while FRET/BRET approaches can monitor real-time interactions in living cells. To validate functional relevance, researchers should compare the enzymatic activities of EHHADH alone versus in complex with interacting partners using in vitro biochemical assays measuring specific activities like enoyl-CoA hydratase or 3-hydroxyacyl-CoA dehydrogenase.
To study EHHADH localization and trafficking in cells, researchers can employ multiple complementary imaging and biochemical techniques. Immunofluorescence microscopy using validated EHHADH antibodies allows visualization of the protein's subcellular distribution, particularly in peroxisomes. For dynamic studies, live-cell imaging with GFP-tagged EHHADH constructs can track protein movement between cellular compartments over time. The pTol2-MCS-EGFP fusion system, which has been successfully used for EHHADH overexpression in zebrafish models, can be adapted for mammalian expression systems to study localization dynamics .
Subcellular fractionation followed by Western blot analysis with EHHADH antibodies can provide quantitative assessment of the protein's distribution across different cellular compartments, with particular attention to peroxisomal fractions. For colocalization studies, dual immunostaining with EHHADH antibodies and markers for peroxisomes (like Pex14 or catalase), mitochondria, or endoplasmic reticulum can reveal potential functional interactions or trafficking patterns. Super-resolution microscopy techniques such as STORM or PALM offer nanoscale precision for visualizing EHHADH distribution within peroxisomes. To study factors influencing EHHADH trafficking, researchers can employ metabolic manipulations such as fasting conditions or treatment with PPAR agonists, as EHHADH is PPAR-inducible and highly responsive to fasting conditions . For protein-protein interactions governing localization, proximity ligation assays or FRET analyses can detect interactions with peroxisomal import machinery components.
Transcriptomic approaches offer powerful insights into EHHADH regulation across metabolic states. RNA-Seq analysis comparing wild-type and EHHADH knockout models can reveal compensatory mechanisms and downstream effectors in fatty acid metabolism pathways. For zebrafish models, quality control steps for RNA-Seq data should include removing joint sequences from raw reads, discarding low-quality bases (quality value <30), removing reads with >10% N content, and discarding sequences <50bp after trimming . Comparative transcriptomics between fed and fasted states can highlight the dynamic regulation of EHHADH, particularly given its enhanced importance during fasting .
When analyzing coexpression networks, researchers should utilize data from genetically diverse populations to capture regulatory patterns. Studies have successfully leveraged data from multiple mouse crosses, including C57BL/6 x BTBR F2 (B6BTBRF2), C57BL/6 x DBA/2J (BxD), and C57BL/6J x C3H/HeJ on ApoE null background (BHF2) . For network construction, selecting the top ~500 EHHADH covariates from each experiment and focusing on the strongest correlates (~45 genes per cross) has proven effective . Functional enrichment analysis using tools like Bingo (Biological Networks Gene Ontology tool) can identify overrepresented GO terms in EHHADH correlates . To validate transcriptomic findings, qRT-PCR should be performed using carefully designed primers (Primer Premier 6.0 software is recommended) with standardized PCR conditions: predenaturation at 98°C for 5 min, followed by 40 cycles of denaturation at 98°C for 30s, quenching at 60°C for 30s, and extension at 72°C for 30s . This comprehensive approach integrates systems biology with targeted validation to elucidate EHHADH's complex regulation.
Several common issues may arise when working with EHHADH antibodies, each requiring specific troubleshooting approaches. For weak or absent signals in Western blots, researchers should first optimize antibody concentration - successful detection has been achieved at 0.4 μg/mL for whole cell lysates and 1 μg/mL for immunoprecipitated samples . If signal remains weak, increasing exposure time to 3 minutes or longer may help, as this duration has proven effective in previous studies . For high background issues, more stringent washing and blocking conditions should be implemented, and secondary antibody concentration should be reduced.
When non-specific bands appear, several strategies can help: using freshly prepared lysates (as EHHADH may be subject to proteolytic degradation), adding protease inhibitors during sample preparation, and optimizing sample denaturation conditions. For immunoprecipitation studies with poor yield, researchers should ensure they're using sufficient antibody (6 μg/mg lysate has been validated) and confirm their cell type expresses adequate levels of EHHADH - HeLa, 293T, and Jurkat cells are known to express detectable levels . When comparing results across different antibodies, researchers should consider epitope differences - some antibodies recognize specific regions of EHHADH (e.g., within the C-terminal region aa 650 to C-terminus) , which may affect detection depending on protein conformation or complex formation. For functional studies, remember that EHHADH knockout in zebrafish does not affect early survival (0-96h) or body weight (30-90 days), so phenotypic changes may be subtle and require specific metabolic challenges to become apparent .
Optimizing Western blot protocols for EHHADH detection requires attention to several key parameters. Based on validated protocols, researchers should prepare liver or cell homogenates in PBS using a dispersion tool followed by sonication, as this method preserves EHHADH integrity . For gel electrophoresis, NuPAGE Bis-Tris mini gels (4-12%) have proven effective for EHHADH separation . When loading samples, 15-50 μg of total protein from whole cell lysates provides adequate detection sensitivity, with even 15 μg of HeLa lysate yielding detectable signals .
For antibody incubation, use EHHADH primary antibody at 0.4 μg/mL for direct lysate detection and 1 μg/mL for immunoprecipitated samples . The ECL detection system has been validated for EHHADH visualization, with an exposure time of 3 minutes typically sufficient for clear band detection . The expected molecular weight for EHHADH is 79 kDa, and researchers should verify that their observed band corresponds to this size . For enhanced visualization and quantification, the Odyssey Infrared Imaging System has been successfully employed in EHHADH studies . When analyzing multiple samples, including positive controls from HeLa, 293T, or Jurkat cell lysates is advisable as these lines have confirmed EHHADH expression . If studying EHHADH in peroxisomal context, consider parallel detection of other peroxisomal proteins like Cyp4a10, Acox1, Hsd17b4, and Abcd3 (PMP70) to establish contextual expression patterns . For normalization, standard housekeeping proteins like β-actin should be included in the protocol.
EHHADH antibodies serve as valuable tools for investigating metabolic disorders and fatty acid oxidation defects. In disease model systems, Western blot analysis using EHHADH antibodies can quantify protein expression changes across different metabolic states or in response to disease progression. Researchers should compare EHHADH levels between healthy controls and disease models, with particular attention to conditions involving peroxisomal dysfunction or fatty acid metabolism abnormalities. For studying the relationship between EHHADH and glucose metabolism, researchers can examine the negative correlation between hepatic EHHADH expression and fasting plasma glucose observed in B6BTBRF2 cross mice . This approach may provide insights into diabetes and insulin resistance mechanisms.
Immunohistochemistry with EHHADH antibodies can reveal alterations in peroxisomal distribution or abundance in tissue samples from metabolic disease models. For comprehensive analysis, researchers should examine EHHADH alongside other peroxisomal proteins like Cyp4a10, Acox1, Hsd17b4, and Abcd3 to establish a complete profile of peroxisomal protein expression in disease states . When studying fatty acid oxidation disorders, measuring medium-chain dicarboxylic acids (DCAs) like C6-DCA is essential, as EHHADH is crucial for their formation and these compounds regulate all fatty acid oxidation pathways . For investigating polyunsaturated fatty acid metabolism disorders, researchers should examine DHA synthesis, as EHHADH plays an essential role in the "Sprecher" pathway for DHA production . In genetic studies, examining EHHADH expression variation (which can vary 1.5-3.7 fold within genetic crosses) may help identify susceptibility factors for metabolic disorders .
EHHADH plays a crucial role in DHA synthesis through the "Sprecher" pathway, and this relationship can be experimentally investigated through several approaches. Genetic manipulation studies provide direct evidence of EHHADH's importance - EHHADH knockout zebrafish models (targeting the second exon with CRISPR/Cas9) show reduced DHA content and inhibited synthesis of n-3 polyunsaturated fatty acids (PUFAs), while EHHADH overexpression promotes DHA synthesis . To create overexpression models, researchers can use pTol2-MCS-EGFP fusion plasmids containing the EHHADH open reading frame, as successfully demonstrated in zebrafish studies .
For metabolic analyses, comparing fatty acid compositions between wild-type and EHHADH-modified organisms under different dietary conditions (such as linseed oil vs. fish oil supplementation) can reveal the dual function of EHHADH in both fatty acid synthesis and oxidation . Researchers should employ comprehensive lipidomic approaches to quantify changes in fatty acid profiles, with particular attention to DHA and other n-3 PUFAs. Transcriptomic analysis of EHHADH knockout models can identify dysregulated genes in the DHA synthesis pathway, providing mechanistic insights into how EHHADH influences DHA production . For functional validation, feeding studies with precursors of DHA synthesis (such as alpha-linolenic acid) can assess the efficiency of conversion to DHA in EHHADH-modified models compared to controls. When designing these experiments, researchers should note that while EHHADH deletion affects DHA metabolism, it does not impact early survival (0-96h) or body weight (30-90 days) in zebrafish models, suggesting compensatory mechanisms may exist for basic developmental functions .