ECSCR Antibody

What is ECSCR and what is its significance in endothelial biology?

ECSCR (Endothelial Cell-Specific Chemotaxis Receptor), also known as ECSM2 and ARIA (Apoptosis Regulator through modulating IAP Expression), is a cell-surface single-transmembrane domain glycoprotein preferentially expressed in endothelial cells . This 205-amino acid protein lacks significant homology to other proteins but contains highly conserved transmembrane and cytoplasmic sequences . ECSCR functions are implicated in cell migration, angiogenesis, and apoptosis through its interactions with several key proteins . Expression studies confirm ECSCR is restricted to endothelial cells both in vivo and in culture, making it a valuable marker of endothelial lineage and endothelial progenitor cells . The protein's conserved cytoplasmic tail links ECSCR to several intracellular processes, including actin cytoskeleton remodeling, EGF receptor signal transduction, and proteasome activity .

What are the optimal methods for ECSCR detection in research applications?

For ECSCR detection, researchers should consider multiple complementary approaches depending on their experimental goals. ELISA has proven effective for quantifying ECSCR in serum samples, with a recommended detection limit of 0.1-5μg/ml as demonstrated in clinical studies of ulcerative colitis patients . For protein expression analysis in cell lysates, Western blotting using anti-ECSCR antibodies targeting the conserved C-terminus yields reliable results, particularly in radioimmune precipitation assay (RIPA) buffer to maximize stringency for co-immunoprecipitation studies . When detecting ECSCR in tissue samples, immunohistochemistry with validated antibodies is recommended, while flow cytometry can identify ECSCR-positive endothelial populations. For mRNA expression analysis, quantitative PCR using validated primer sets (e.g., GCGGTTTTTAATACTCTCGTG and GACTCACTTTACTAGCCTTTGG) and probe sequences (/56-FAM/AAC AGC GTC CCT TGA GGT TGA CA/3IABlk_FQ/) has been successfully employed, with β-actin serving as an appropriate reference gene for normalization via the delta-deltaCt method .

How does ECSCR interact with the VEGF signaling pathway?

ECSCR plays a critical role in modulating VEGF signaling through its association with KDR (VEGFR2), a key vascular endothelial growth factor receptor. Biochemical studies demonstrate that ECSCR directly associates with KDR, both under basal conditions and following VEGF stimulation . This interaction is maintained even when ECSCR lacks most of its conserved cytoplasmic domain (ECSCR-ΔC), suggesting the interaction may involve the transmembrane or extracellular regions . Functionally, ECSCR is required for full KDR activation upon VEGF stimulation, as evidenced by reduced KDR tyrosine phosphorylation in ECSCR-silenced endothelial cells . Beyond activation, ECSCR also influences the proteolysis of internalized KDR, representing a novel regulatory mechanism for VEGF signaling in endothelial cells . This ECSCR-KDR interaction has significant implications for angiogenic processes and vascular development.

What methodology is most effective for studying ECSCR-protein interactions?

For investigating ECSCR-protein interactions, co-immunoprecipitation (co-IP) in RIPA buffer has proven highly effective, particularly for detecting interactions with KDR/VEGFR2 . When designing co-IP experiments, researchers should consider:

• Expression validation: For recombinant systems, co-transfection of HEK293 cells with KDR and tagged ECSCR constructs (full-length or domain-specific) provides a controlled system for interaction studies .

• Antibody selection: For endogenous protein interactions, use affinity-purified antibodies against the conserved C-terminus of ECSCR to maximize specificity .

• Bidirectional validation: Perform reverse IPs (e.g., pull down with anti-KDR and blot for ECSCR) to confirm interactions .

• Structure-function analysis: Employ truncation mutants (such as ECSCR-ΔC lacking the cytoplasmic domain) to identify critical interaction domains .

For detection of transient or weak interactions, consider proximity ligation assays or FRET-based approaches to complement traditional co-IP methods. When examining downstream signaling consequences, phospho-specific antibodies targeting key residues in KDR (Y996, Y951, Y1059, and Y1175) should be employed to assess activation status .

How can ECSCR antibodies be utilized to investigate its role in ulcerative colitis?

Recent research has identified ECSCR as a potential biomarker for ulcerative colitis (UC), with significant implications for diagnosis and monitoring. When investigating ECSCR in UC, researchers should implement a multi-faceted approach:

• Serum quantification: ELISA using validated ECSCR antibodies can detect elevated ECSCR levels in UC patient serum. In clinical validation studies, serum was collected from 40 UC patients and 25 normal controls, with ECSCR concentrations calculated from standard curves following microplate reader analysis at 450 nm .

• Correlation with disease parameters: Statistical analysis should include Spearman's correlation to assess relationships between ECSCR levels and clinical parameters, particularly neutrophil counts, as ECSCR has been shown to positively correlate with neutrophil levels in UC patients .

• Expression validation in tissue: For biopsy samples, RT-qPCR can confirm ECSCR upregulation at the transcript level, while immunohistochemistry can identify cellular sources of ECSCR in intestinal tissue.

• Treatment response monitoring: ECSCR levels can be tracked pre- and post-treatment, as demonstrated in studies with golimumab (GLM), where ECSCR expression remained elevated compared to healthy controls even after treatment-induced clinical remission .

• Disease activity correlation: Analyze ECSCR expression in relation to established disease activity metrics like the Mayo score, as high Mayo scores (>5) have been associated with significantly upregulated ECSCR expression .

What methodological approaches can distinguish ECSCR's role in different vascular pathologies?

To differentiate ECSCR's functional roles across various vascular pathologies, researchers should employ comparative analysis methodologies:

• Single-cell RNA sequencing: This approach enables comprehensive analysis of transcriptional heterogeneity in vascular cells, as demonstrated in studies of induced pluripotent stem cell-derived endothelial cells (iPSC-ECs) . This technology allows identification of ECSCR expression in specific endothelial subpopulations marked by other endothelial markers such as CLDN5, APLNR, GJA5, and ESM1 .

• Gene set enrichment analysis (GSEA): This computational method can identify relevant molecular pathways associated with ECSCR in different disease contexts. When applying GSEA, researchers should utilize established databases like the Molecular Signatures Database (https://www.gsea-msigdb.org/gsea/msigdb/index.jsp) with appropriate gene sets .

• Immune infiltration analysis: The CIBERSORT algorithm can assess differential immune cell presence in relation to ECSCR expression, particularly relevant for inflammatory vascular conditions . This approach has revealed significant correlations between ECSCR and specific immune cell populations, including macrophage subtypes and neutrophils in UC .

• Cross-disease comparison: External validation across multiple disease datasets (e.g., GSE11223, GSE107499, GSE53306, GSE206285 for UC) using consistent statistical methods like the Wilcoxon rank sum test allows researchers to identify disease-specific versus common ECSCR expression patterns .

What are the optimal approaches for ECSCR gene silencing in functional studies?

For effective ECSCR silencing in functional studies, several validated approaches have been documented:

• siRNA transfection: Transient knockdown using validated siRNAs (such as Qiagen SI04328177 or Sigma SASI_Hs02_00313147) delivered via lipofection provides effective silencing in endothelial cells . For optimal transfection efficiency in human pulmonary artery endothelial cells (HPAECs) or HUVECs, researchers typically use 500 ng of ECSCR siRNA, with lacZ siRNA serving as an appropriate control .

• Post-silencing validation: Knockdown efficiency should be assessed at both mRNA level (via RT-qPCR) and protein level (via Western blot) at 24-48 hours post-transfection.

• Functional readouts: Following ECSCR silencing, migration assays using Boyden chambers represent a validated approach to assess functional consequences. Standardized protocols include seeding 2×10^4 silenced cells per well in serum-free media in upper chambers placed over lower chambers containing either 10% FCS with endothelial growth supplements or purified VEGF (25 ng/mL) in endothelial basal medium . Migration should be quantified after 5 hours by counting cells in triplicate wells from 5 different fields at 10× or 20× magnification .

• Signaling analysis: For investigating ECSCR's role in signaling pathways, ECSCR-silenced cells should be serum-starved overnight before stimulation with 25 ng/mL VEGF165 for short time intervals (2-5 minutes) . Phosphorylation status of key signaling molecules should be assessed via Western blot using phospho-specific antibodies.

How can ECSCR structure-function relationships be effectively investigated?

To elucidate ECSCR structure-function relationships, researchers should implement domain-specific experimental strategies:

• Chimeric construct design: Generate recombinant constructs based on human ECSCR (GenBank accession no. NP_001071161) with domain swaps or truncations to identify functional regions. Validated constructs include ECSCR-ΔC (ECSCR sequence up to residue Glu165) for cytoplasmic domain function analysis .

• Domain-specific mutations: Target conserved residues in each domain based on sequence alignment across species to identify critical functional amino acids.

• Protein-protein interaction mapping: For each mutant construct, evaluate interactions with known ECSCR binding partners including filamin-A, phosphatase and tensin homologue, and KDR through co-immunoprecipitation studies .

• Live-cell imaging: Utilize fluorescently tagged ECSCR constructs to visualize subcellular localization and trafficking in response to stimuli. Previous studies have confirmed plasma membrane expression using ECSCR-GFP fusion proteins in endothelial cells .

• Functional rescue experiments: After ECSCR silencing, reintroduce domain-specific mutants to identify which regions are necessary and sufficient for specific cellular functions such as migration, angiogenesis, or VEGF signaling modulation.

How can single-cell technologies advance our understanding of ECSCR in vascular heterogeneity?

Single-cell technologies offer powerful approaches to understand ECSCR's role in vascular heterogeneity:

• Droplet-based scRNA-seq: This technology enables parallel analysis of thousands of cells, providing comprehensive insights into transcriptional heterogeneity . For investigating ECSCR in vascular contexts, researchers should consider applying this approach to:

  • Developing vasculature during embryogenesis

  • Patient-derived endothelial cells from vascular diseases

  • Tumor-associated endothelial cells

• Endothelial subpopulation identification: Recent scRNA-seq studies have identified four distinct subpopulations of induced pluripotent stem cell-derived endothelial cells (iPSC-ECs), marked by expression of CLDN5, APLNR, GJA5, and ESM1 . Researchers should examine ECSCR expression patterns across these subpopulations to understand its role in endothelial heterogeneity.

• Trajectory analysis: Apply computational methods to scRNA-seq data to reconstruct developmental or activation trajectories of endothelial cells, positioning ECSCR in the temporal sequence of endothelial differentiation or activation.

• Integration with spatial transcriptomics: Combine single-cell expression data with spatial information to understand ECSCR expression in the context of vascular beds in different organs.

What are the methodological considerations for investigating ECSCR as a biomarker in inflammatory conditions?

When evaluating ECSCR as a biomarker in inflammatory conditions, researchers should consider these methodological approaches:

• Multi-cohort validation: Validate findings across independent patient cohorts, as demonstrated in UC studies using multiple GSE datasets (GSE11223, GSE107499, GSE53306, GSE206285) .

• Correlation with established biomarkers: Compare ECSCR performance against validated biomarkers. In UC, ECSCR expression correlates positively with neutrophil levels and Mayo scores, suggesting potential complementarity to existing biomarkers .

• Treatment response monitoring: Assess ECSCR dynamics during treatment, as shown in the GSE92415 dataset where ECSCR levels were tracked before and after golimumab treatment in UC patients .

• Multivariate analysis: Combine ECSCR with other biomarkers in multivariate models to improve diagnostic or prognostic performance. Consider including other genes identified in UC studies such as THY1, SLC6A14, FAP, and GPR109B alongside ECSCR .

• Standardization of detection methods: For clinical application, standardize ELISA procedures with defined detection limits (0.1-5μg/ml for serum ECSCR) and established normal reference ranges based on healthy control populations.

• Correlative immune cell analysis: Implement comprehensive immune profiling alongside ECSCR quantification, as ECSCR shows significant positive correlation with macrophage M0/M1 infiltration and neutrophils in inflammatory conditions .