EDC4 Antibody, FITC conjugated

How does EDC4 contribute to DNA damage response?

EDC4 contributes to the DNA damage response through its nuclear functions, where it is quickly recruited to DNA double-strand breaks (DSBs) (within 5 seconds), similar to BRCA1 and BRIP1. When cells experience DNA damage, EDC4 undergoes post-translational modifications including ubiquitination at lysines 514 and 1157 and phosphorylation at serine 741, which are crucial for its function in DNA damage resistance . Mutation studies have demonstrated that lysine-to-arginine substitutions at positions K514 and K1157 result in increased sensitivity to DNA crosslinking agents like diepoxybutane (DEB) and increased chromosome fragility, indicating these modifications are essential for EDC4's DNA repair function .

What is the significance of EDC4 in cancer research?

EDC4 has emerged as a significant protein in cancer research due to its phenocopy of BRCA1 function in DNA repair pathways. Studies have shown that EDC4 depletion renders cells hypersensitive to interstrand crosslinking (ICL) drugs, similar to BRCA1 deficiency . Furthermore, germline mutations in the EDC4 gene have been investigated in breast cancer cases, particularly in patients who fulfill criteria for hereditary breast and ovarian cancer (HBOC) syndrome but lack pathogenic mutations in BRCA1 or BRCA2 . Additionally, EDC4 has been implicated in cisplatin resistance in cervical cancer through its interaction with Replication Protein A (RPA) . These associations make EDC4 a valuable target for cancer diagnostic and therapeutic research.

How can FITC-conjugated EDC4 antibodies enhance flow cytometry experiments?

FITC (Fluorescein isothiocyanate) conjugation provides direct fluorescent labeling for antibodies, eliminating the need for secondary detection reagents in flow cytometry applications. For EDC4 research, FITC-conjugated antibodies can facilitate multiparameter analysis of cellular populations when studying DNA damage response pathways, particularly for analyzing protein expression changes in response to genotoxic agents. The FITC fluorophore has an excitation maximum at approximately 495 nm and emission maximum at 519 nm, allowing detection through standard flow cytometry channels without spectral overlap with common fluorophores like PE or APC. When designing panels for EDC4 detection alongside other markers (like γH2AX for DNA damage), researchers should account for FITC's brightness and potential photobleaching characteristics.

What cell types and tissues have been validated for EDC4 antibody reactivity?

Published data indicates that EDC4 antibodies have demonstrated reactivity in human, mouse, and rat samples . Specifically, positive Western blot detection has been reported in HeLa and HepG2 cell lines . For immunohistochemistry applications, EDC4 antibodies have successfully detected the target protein in human liver cancer tissue and human colon cancer tissue . For immunofluorescence applications, HeLa cells have been extensively validated . When designing experiments with FITC-conjugated EDC4 antibodies, researchers should consider that background autofluorescence may vary between tissue types, potentially affecting signal-to-noise ratios in the FITC channel.

What fixation and permeabilization protocols are optimal for FITC-conjugated EDC4 antibody staining?

For optimal results with FITC-conjugated EDC4 antibodies in flow cytometry or microscopy applications, fixation with 4% paraformaldehyde for 15-20 minutes at room temperature followed by permeabilization with 0.1-0.5% Triton X-100 is recommended for intracellular staining. Since EDC4 localizes to both cytoplasmic P-bodies and nuclear compartments, complete permeabilization is essential for consistent staining. For flow cytometry applications specifically, methanol fixation/permeabilization protocols may provide superior results but could potentially affect FITC fluorescence intensity, requiring validation. When analyzing nuclear EDC4 in relation to DNA damage, coordination with cell cycle analysis may require specialized protocols that preserve both protein epitopes and DNA staining capability.

How should researchers optimize signal detection for FITC-conjugated EDC4 antibodies?

Optimization strategies for FITC-conjugated EDC4 antibodies should include titration experiments to determine the minimum antibody concentration that provides maximum signal-to-noise ratio. Typically, starting with manufacturer-recommended dilutions (e.g., 1:200-1:800 for immunofluorescence applications) is advisable . Additionally, researchers should implement controls including isotype-matched FITC-conjugated antibodies and blocking validation. For multicolor flow cytometry, proper compensation controls are essential due to FITC's relatively broad emission spectrum that may overlap with PE signals. When studying DNA damage response pathways, researchers might need to increase antibody concentration when detecting EDC4 at repair foci, as localized protein concentrations at these sites might be lower than in P-bodies.

What are the best approaches for quantifying EDC4 protein levels using FITC-conjugated antibodies?

For quantitative analysis of EDC4 protein levels using FITC-conjugated antibodies, researchers should establish standardized protocols that account for instrument settings, antibody lots, and cellular conditions. In flow cytometry applications, mean fluorescence intensity (MFI) values provide reliable quantitation when compared against calibration standards. For microscopy-based quantification, integrated density measurements of fluorescence signal can be normalized to cell number or nuclear area. When studying EDC4's dual localization, separate quantification of cytoplasmic versus nuclear signals may provide insights into protein redistribution following DNA damage. Time-course experiments should account for potential photobleaching of the FITC fluorophore during repeated measurement or extended imaging sessions.

How can FITC-conjugated EDC4 antibodies be used to investigate the protein's dual roles in RNA processing and DNA repair?

To investigate EDC4's dual functionality, researchers can design experiments that stimulate one pathway while monitoring effects on the other. For example, inducing DNA damage with agents like cisplatin or diepoxybutane can trigger EDC4 recruitment to damage sites, which can be tracked using FITC-conjugated antibodies in live-cell imaging or fixed-cell flow cytometry . Comparing the kinetics of EDC4 localization to DNA damage sites versus P-bodies can reveal potential competition between these pathways. Co-staining with markers for P-bodies (like DCP1a) and DNA damage (γH2AX) alongside FITC-conjugated EDC4 antibodies can provide spatial and temporal information about EDC4's distribution between these compartments. Additionally, researchers might implement CRISPR/Cas9-mediated mutagenesis of specific EDC4 domains to determine which regions are essential for each function.

What strategies can address non-specific binding when using FITC-conjugated EDC4 antibodies?

Non-specific binding is a common challenge with fluorescently conjugated antibodies. For FITC-conjugated EDC4 antibodies, researchers should implement several strategies to minimize this issue. First, optimization of blocking conditions is critical—using a combination of serum (matching the secondary antibody species for other channels) and bovine serum albumin (3-5%) can reduce background. Second, including a pre-adsorption step with cell or tissue lysates from EDC4-knockout samples can reduce off-target binding. Third, comparison with unconjugated primary EDC4 antibody plus FITC-conjugated secondary antibody can help determine whether non-specific binding is related to the conjugation process. Finally, researchers should validate specificity by performing knockdown/knockout experiments, demonstrating proportional signal reduction corresponding to protein depletion levels .

How can researchers distinguish between different EDC4 post-translational modifications using FITC-conjugated antibodies?

Distinguishing between different post-translational modifications (PTMs) of EDC4, such as ubiquitination at K514/K1157 or phosphorylation at S741, requires specialized approaches . One strategy involves using FITC-conjugated EDC4 antibodies in combination with modification-specific antibodies in different fluorescent channels. For flow cytometry applications, this allows correlation analysis between total EDC4 levels and specific modifications. Another approach involves immunoprecipitation with FITC-conjugated EDC4 antibodies followed by western blotting with modification-specific antibodies. Researchers might also employ site-specific mutant constructs (K514R, K1157R, S741A) in rescue experiments to determine functional consequences of specific modifications . For tracking dynamics of modifications after DNA damage, time-course experiments with FITC-conjugated EDC4 antibodies and PTM-specific antibodies can reveal sequential modification patterns.

What control samples are essential when studying EDC4 with FITC-conjugated antibodies?

Rigorous experimental design for EDC4 studies using FITC-conjugated antibodies should include multiple controls. First, EDC4-depleted cells (via shRNA or CRISPR/Cas9) are essential for validating antibody specificity . The search results specifically mention successful shRNA sequences for EDC4 knockdown: "Sh-EDC4 #1: GGTGATAGTACCTCAGCAAAC; Sh-EDC4 #2: GCCACCCATTAACCTGCAAGA" . Second, isotype-matched FITC-conjugated irrelevant antibodies help establish background fluorescence levels. Third, unstained and single-color controls are necessary for multiparameter flow cytometry to establish proper compensation. Fourth, when studying DNA damage responses, appropriate positive controls (cells treated with DNA-damaging agents) and negative controls (untreated cells) should be included. Fifth, appropriate cellular models should be selected based on EDC4 expression levels—HeLa and SiHa cells have been validated in previous studies .

How can researchers effectively study EDC4's interaction with BRCA1 and other DNA repair proteins?

To investigate EDC4's interactions with BRCA1 and other DNA repair proteins, researchers can implement several complementary approaches using FITC-conjugated EDC4 antibodies. Co-immunoprecipitation experiments can confirm physical interactions between EDC4 and partners like BRCA1, BRIP1, and TOPBP1 . For visualization of co-localization at DNA damage sites, dual immunofluorescence using FITC-conjugated EDC4 antibodies and differently labeled antibodies against interaction partners can be performed, followed by confocal microscopy and colocalization analysis. Proximity ligation assays (PLA) offer higher specificity for detecting protein-protein interactions within 40nm distance in situ. For functional studies, researchers might implement epistasis analysis by depleting both EDC4 and potential partners (e.g., BRCA1) to determine whether they function in the same or parallel pathways . The timing of recruitment to DNA damage sites can be studied using laser microirradiation combined with live-cell imaging of fluorescently tagged proteins.

What experimental approaches can help determine if EDC4 mutations affect DNA repair capacity?

To assess whether EDC4 mutations affect DNA repair capacity, researchers can employ several experimental approaches. Cell survival assays using DNA crosslinking agents like mitomycin C (MMC), diepoxybutane (DEB), or cisplatin can reveal sensitivity phenotypes in cells expressing mutant EDC4 compared to wild-type . Chromosome fragility assays, such as the flow cytometric micronucleus (MN) assay or metaphase spread analysis, can quantify genomic instability resulting from defective repair . Cell cycle analysis following DNA damage can identify abnormal G2/M arrest patterns characteristic of repair defects . Homologous recombination (HR) repair efficiency can be directly measured using reporter assays in cells expressing wild-type versus mutant EDC4 . For specific mutation analysis, researchers might compare the published EDC4 mutations K514R, K1157R, and S741A, which have shown differential effects on DNA damage sensitivity .

How might FITC-conjugated EDC4 antibodies contribute to cancer biomarker development?

FITC-conjugated EDC4 antibodies could significantly contribute to cancer biomarker development through several innovative approaches. Flow cytometry-based assays could be developed to assess EDC4 expression levels and subcellular localization in patient-derived samples, potentially correlating patterns with treatment response or prognosis. Combination with DNA damage markers could create multiparameter profiles that better predict therapeutic sensitivity, particularly to platinum compounds or PARP inhibitors . Since EDC4 phenocopies BRCA1 function, detection of aberrant EDC4 expression or localization might identify "BRCAness" phenotypes in tumors without BRCA mutations, expanding the population that might benefit from specific targeted therapies . Longitudinal monitoring of EDC4 patterns during treatment could potentially track development of resistance mechanisms, particularly in cervical cancer where EDC4 has been implicated in cisplatin resistance .

How does EDC4's role in RNA processing intersect with its DNA repair function at the molecular level?

The intersection between EDC4's RNA processing and DNA repair functions represents a fascinating area for future research. One hypothesis is that EDC4 might regulate expression of DNA repair genes through its mRNA decapping activity, creating a feedback loop that calibrates repair capacity. Alternatively, EDC4 might directly participate in RNA-DNA hybrid (R-loop) resolution, which are structures that form during transcription and can lead to genomic instability if not properly processed. Research using FITC-conjugated EDC4 antibodies could track the protein's dynamic redistribution between P-bodies and DNA damage sites under various cellular stresses, revealing potential competition between these functions. Proteomics approaches might identify differential interaction partners in each compartment, illuminating context-specific functions. Understanding this dual functionality could reveal novel regulatory mechanisms connecting RNA metabolism to genome stability, potentially identifying new therapeutic vulnerabilities in cancers with altered EDC4 function.