EDNRA Antibody
Description
Introduction to EDNRA Antibody
EDNRA antibodies target the endothelin receptor type A, a 427-amino-acid transmembrane protein (48.7 kDa) expressed in vascular smooth muscle cells, pericytes, and tumor microenvironments . EDNRA binds ET-1 with high affinity, activating pathways like PI3K-AKT, WNT, and Hedgehog, which are implicated in cancer progression and immune regulation .
Applications of EDNRA Antibodies
EDNRA antibodies are validated for:
-
Western Blot (WB): Detects EDNRA in human, mouse, and rat tissues .
-
Immunohistochemistry (IHC): Identifies EDNRA in gastric cancer (STAD), myeloma bone marrow, and vascular smooth muscle cells .
-
Immunofluorescence (IF): Visualizes EDNRA co-localization with immune markers (e.g., renin in kidney cells) .
-
Flow Cytometry (FCM): Quantifies EDNRA expression in transfected cell lines .
Cancer Biology
-
Gastric Cancer (STAD): High EDNRA expression correlates with advanced T stage (HR = 1.719, P = 0.011), poor survival (HR = 1.638, P = 0.004), and immune infiltration (NK cells: R = 0.599, P < 0.001) .
-
Colorectal Cancer: EDNRA upregulation drives tumor progression via STAT3 signaling and predicts poor prognosis .
-
Myeloma: EDNRA+ mesenchymal cells expand in tumor-infiltrated bone marrow, promoting disease progression .
Immune Modulation
EDNRA regulates macrophage infiltration (R = 0.653, P < 0.05) and synergizes with immune checkpoints (PDCD1LG2, HAVCR2) to suppress antitumor immunity .
Cardiovascular Effects
EDNRA mediates ET-1-induced vasoconstriction and retinal ganglion cell death in hypertension models .
Univariate Cox Regression in STAD
| Characteristic | HR (95% CI) | P-value |
|---|---|---|
| EDNRA (High vs. Low) | 1.638 (1.174–2.286) | 0.004 |
| T stage (T3&T4 vs. T1&T2) | 1.719 (1.131–2.612) | 0.011 |
| Macrophage infiltration | 2.183 (0.971–4.910) | 0.059 |
Therapeutic Implications
-
EDNRA Antagonists: Inhibit tumor growth in CRC and ovarian cancer .
-
Immune Checkpoint Synergy: EDNRA correlates with PD-1/CTLA-4 blockade resistance, suggesting combinatorial targeting .
Limitations and Future Directions
Current antibodies exhibit variable cross-reactivity (e.g., Alomone’s #AER-001 works best in rodents ). Future studies should optimize human-specific clones and explore EDNRA’s role in immunotherapy resistance.
Product Specs
Target Background
- A study in a Ukrainian population found no link between EDNRA rs5335 and the risk of large artery stroke. PMID: 29849817
- miR200c regulates the proliferation, apoptosis, and invasion of gastric carcinoma cells by downregulating EDNRA expression. PMID: 29286062
- Increased expression of SST5, CXCR4, and ETA on tumor cells and SST3, CXCR4, and ETA on microvessels was observed in progressively higher grades of tumors (II to IV). PMID: 29696364
- There is no association between the C+70G polymorphism of the EDNRA gene and the development of ischemic atherothrombotic stroke. PMID: 29064794
- Endothelin-A receptor-activated ABCB1 expression plays a role in nintedanib resistance in FGFR1-driven small cell lung cancer. PMID: 27367030
- Endothelin-1 exhibits an anti-apoptotic effect in vascular endothelial cells, primarily mediated by the activation of EDNRB, with a minor contribution from EDNRA. PMID: 28732172
- Both ETA and ETB receptors are present in human hemorrhoids, with ETB receptors being more prevalent. PMID: 28095606
- ETAR stimulation suppresses the Hippo pathway via downstream G-protein Galphaq/11 and Rho GTPase, leading to YAP/TAZ activation, which is essential for ETAR-induced tumorigenesis. These findings highlight the critical role of the YAP/TAZ axis in ETAR signaling. PMID: 28249901
- Research demonstrates that endothelin A receptor drives invadopodia function through direct interaction of beta-arrestin-1 (beta-arr1) with Rho guanine nucleotide exchange factor (GEF) 11 protein (PDZ-RhoGEF). PMID: 26522724
- In normal arteries, ETAR is expressed by vascular smooth muscle cells in the media, while ETBR expression is minimal. In giant cell arteritis, both ETAR and ETBR receptors are expressed by alphaSMA-positive cells at the intima-media border. Endothelial cells and inflammatory cells also express both ET receptors. PMID: 28606962
- Evidence suggests that TNFalpha (tumor necrosis factor-alpha) induces proliferation of airway smooth muscle cells via ET1 (endothelin-1), GM-CSF (granulocyte-macrophage colony-stimulating factor), and IL6 (interleukin 6) signaling. ET1 stimulates cell proliferation through ETAR (endothelin receptor type A), while ETBR (endothelin receptor type B) is upregulated by TNFalpha and appears to mediate ET1 effects on cell proliferation. PMID: 27422754
- The presence of ET-1 receptors in chronic thrombus in proximal CTEPH suggests that ET-1 could not only influence the distal vasculopathy in unobstructed vessels but also stimulate smooth muscle cell proliferation within the chronic clot. PMID: 26874031
- Research shows that auriculo-condylar syndrome (ACS)-associated mutations in G protein subunit alpha i3 (GNAI3) produce dominant-negative Galpha(i3) mutant proteins that couple to endothelin type A receptor (ET(A)R). PMID: 27072656
- Patients with lung fibrosis and those with a high modified Rodnan skin score exhibited a reduced endothelin 1 Type A receptor (ETAR)/ETBR ratio. PMID: 26773103
- High ETAR expression is associated with ovarian carcinoma. PMID: 26675258
- Data indicate that macitentan interferes with the profibrotic action of transforming growth factor-beta (TGF-beta), blocking the endothelin receptor type A (ET-1 receptor) portion of the ET-1/TGF-beta receptor complex. PMID: 26357964
- Ednra, encoding Endothelin receptor A (ETA)-the target of Endothelin 1 (ET-1)-was significantly elevated in Systemic Capillary Leak Syndrome blood-outgrowth endothelial cells compared to healthy controls. PMID: 26176954
- Gene-based analyses revealed associations of the EDNRA gene with longitudinal Blood Pressure phenotypes, associations with essential hypertension, Blood Pressure salt sensitivity, preeclampsia, or preclinical stages of atherosclerosis. PMID: 25424718
- Endothelin receptor A was detected in all patients with squamous cell carcinoma and psoriasis, with a higher frequency and grade of expression than controls and basal cell carcinoma. PMID: 25946671
- The objective was to quantify the density of ETA and ETB receptors in cardiopulmonary tissue from pulmonary arterial hypertension patients and the monocrotaline (MCT) rat. PMID: 24582810
- Findings suggest a potential role for agonistic autoantibodies-induced activation of immune cells mediated by the AT1R and the ETAR in the pathogenesis or even the onset of systemic sclerosis. PMID: 24612997
- Polymorphisms of EDNRA have been linked to the development of group I pulmonary hypertension, dilated cardiomyopathy, and essential hypertension. PMID: 24570333
- Mutations in the endothelin receptor type A are responsible for mandibulofacial dysostosis with alopecia. PMID: 25772936
- Significant single nucleotide polymorphism associations with birth weight near coding regions for two genes involved in oxygen sensing and vascular control, PRKAA1 and EDNRA, respectively, were identified. PMID: 25225183
- No significant association was found between EDNRA (C+70G, G-231A) allele and Hashimoto's thyroiditis in a Turkish population; however, this polymorphism may relate to a decreased risk for early disease onset. PMID: 24815860
- Upon endothelin-1 (ET-1) stimulation, ET type A receptor (ETAR) is recycled back to the plasma membrane, while ET type B receptor (ETAR) is targeted to the lysosome for degradation. PMID: 25381251
- A functional link is suggested between endothelin receptor autoantibody formation and down-regulated midkine serum levels, which may be relevant in the pathogenesis of clinically significant peripheral artery occlusive disease. PMID: 25056169
- A genetic association study conducted in India suggests that an SNP in EDNRA (rs5335), in addition to mutations in cystic fibrosis transmembrane conductance regulator, is associated with congenital absence of vas deferens in the population studied. PMID: 24958810
- These findings reveal a novel mechanism by which ETAR/beta-arr1 signaling is integrated with the Wnt/beta-catenin pathway to sustain chemoresistance in epithelial ovarian cancer, providing a strong rationale for clinical evaluation. PMID: 25377471
- No association was found between Graves' disease and genetic polymorphism. PMID: 24291390
- EDNRA mRNA expression was elevated in reflux esophagitis and Barrett's esophagus compared to controls. PMID: 23384184
- ETAR and CXCR4 expression levels are potential prognostic biomarkers in nasopharyngeal carcinoma patients. PMID: 23987636
- Mutation of EDNRA is implicated in ACTH-independent macronodular adrenal hyperplasia. PMID: 23754170
- A sample of 250 surgical patients was utilized to describe the distribution of ET-1, ETA, and ETB polymorphisms in the aneurysmal subarachnoid hemorrhage population. PMID: 22997346
- ETAR overexpression promoted colon cancer liver metastases. PMID: 23818293
- Serum levels of ETAR autoantibodies have been reported in peripheral arterial disease. PMID: 24627317
- The positive correlation between ET-1 and ETAR in lesional compared with perilesional normal epidermis suggests a significant role for this receptor in vitiligo. PMID: 23683481
- Desensitization and internalization of endothelin receptor A: impact of G protein-coupled receptor kinase 2 (GRK2)-mediated phosphorylation. PMID: 24064210
- The presence of ETr-A and ETr-B in rheumatic mitral valves suggests their interaction with the c endothelins system, particularly ETr-B detected in a greater proportion, which could explain the lack of endothelin expression in rheumatic mitral valve. PMID: 23515723
- Genetic deletion of a nephron-specific endothelin A receptor causes very modest fluid retention that does not alter arterial pressure, nor does it play a major role in regulating sodium excretion or systemic hemodynamics. PMID: 23217151
- The mRNA expressions of endothelin A and B receptors and endothelin-1 are significantly increased in patients with failed Fontan procedures. PMID: 21356562
- A significant difference existed between migraineurs and controls with the AA genotype versus AG+GG. Pooled relative risk with fixed effect was 4.04. This meta-analysis suggests a significant association between the EDNRA -231G>A polymorphism and migraine. PMID: 23058564
- Right ventricular hypertrophy myocardial endothelin type A receptor level is increased compared to nonhypertrophied right ventricular endothelin receptor level. PMID: 23233754
- Findings suggest a potential link between specific genotypes in the ednra gene and susceptibility to pulmonary arterial hypertension. PMID: 21773759
- Both endothelin A and B receptors were reduced in pulmonary arterial hypertension, particularly type B, and type B signaling through protein kinases was markedly reduced in vascular smooth cells with a mutation in bone morphogenetic protein receptor 2. PMID: 22688668
- Endothelin A receptor and epidermal growth factor receptor signaling converge on beta-catenin to promote ovarian cancer metastasis. PMID: 22480520
- ETB receptors predominated in normal human liver and displayed the highest ratio (ETB:ETA 63:47) compared with other peripheral tissues. Liver ETB expression was upregulated in cirrhosis (ETB:ETA 83:17). PMID: 22365955
- Expressed recombinant ET(A) as a fusion protein with phi6 p9 envelope protein. The purified protein showed specific binding to ET-1 and the alpha subunit of G(q) protein. PMID: 22561246
- SNP, rs6842241, near EDNRA at chromosome 4q31.22 (combined P-value = 9.58 x 10(-9); odds ratio = 1.25), was found to be significantly associated with intracranial aneurysm. PMID: 22286173
- Data show that optical imaging with a fluorescent ET(A)R tracer allows the noninvasive imaging of tumor-associated ET(A)R expression in vivo. PMID: 22510270
Q&A
What is EDNRA and what are its key characteristics?
EDNRA (endothelin receptor type A) is a G-protein coupled receptor that functions as a receptor for endothelin-1. In humans, the canonical protein has 427 amino acid residues with a molecular mass of 48.7 kDa and is primarily localized in the cell membrane. Up to five different isoforms have been reported, and the protein undergoes post-translational modifications, particularly glycosylation. EDNRA is a member of the G-protein coupled receptor 1 family and serves as a marker for Deep-Layer Corticothalamic And 6B Neurons, Cerebral Cortex MGE Interneurons, and Gray Matter CGE Interneurons .
What are the common applications for EDNRA antibodies in research?
EDNRA antibodies are employed in multiple experimental techniques:
| Application | Typical Dilution | Sample Type | Special Considerations |
|---|---|---|---|
| Western Blot | 1:100-1:1000 | Cell/tissue lysates | Use PVDF membranes, BSA blocking |
| IHC | 1:100 | Paraffin sections | Overnight incubation at 4°C |
| IF | 1:50-1:200 | Fixed cells/tissues | Careful membrane permeabilization |
| ELISA | 1:100-1:500 | Serum, cell supernatants | Validate specificity |
| Flow Cytometry | 1:50-1:100 | Cell suspensions | Surface vs. intracellular protocols |
Over 90 citations in scientific literature describe EDNRA antibody use in research contexts .
How should EDNRA antibodies be validated before experimental use?
Proper validation requires:
-
Positive controls using tissues or cell lines with known EDNRA expression
-
Negative controls with tissues/cells lacking EDNRA expression
-
Technical controls including primary antibody omission and isotype controls
-
Specificity testing using EDNRA knockdown or knockout samples
-
Cross-reactivity assessment across species if performing comparative studies
-
Application-specific validation (different for WB, IHC, IF, etc.)
What is the recommended protocol for EDNRA immunohistochemistry?
Based on published research, optimal EDNRA immunohistochemistry involves:
-
Fixation in neutral formaldehyde
-
Paraffin embedding with 4 μm sectioning
-
Streptavidin-peroxidase immunohistochemical method for enhanced staining
-
Overnight incubation at 4°C with anti-EDNRA (1:100 dilution)
-
Light counterstaining with hematoxylin
-
Evaluation by two independent pathologists assessing both staining intensity and percentage of stained cells in representative areas
Why might Western blots with EDNRA antibodies show multiple bands?
Multiple bands in EDNRA Western blots may result from:
-
Presence of multiple protein isoforms (up to 5 have been documented)
-
Post-translational modifications, particularly glycosylation
-
Proteolytic degradation during sample preparation
-
Non-specific binding or cross-reactivity with related receptors
Recommendations include using fresh samples with protease inhibitors, optimizing reducing conditions, and comparing patterns with positive control samples.
What methods are available for quantifying EDNRA expression?
| Method | Advantages | Limitations | Best Applications |
|---|---|---|---|
| qPCR | High sensitivity, quantitative | Measures mRNA not protein | Gene expression studies |
| Western Blot | Detects protein, shows isoforms | Semi-quantitative | Protein expression screening |
| ELISA | Highly quantitative | Limited spatial information | Secreted or soluble forms |
| IHC/IF | Spatial information, cell-specific | Semi-quantitative | Tissue localization studies |
| Flow Cytometry | Single-cell resolution | Requires cell suspensions | Cell surface expression |
How does EDNRA expression correlate with cancer prognosis?
EDNRA expression has significant prognostic value in various cancers. Research has shown that EDNRA expression levels are associated with patient's age and tumor stage. Receiver Operating Characteristic (ROC) curve analysis has demonstrated the diagnostic value of EDNRA in cancer detection. Kaplan-Meier and Cox regression analyses have validated the survival and prognostic significance of EDNRA expression, which has been further confirmed through immunohistochemistry cohort studies .
What is the relationship between EDNRA and tumor immune cell infiltration?
EDNRA expression shows significant correlations with immune cell infiltration in tumor microenvironments:
| Immune Cell Type | Correlation with EDNRA | p-value |
|---|---|---|
| Mast cells | Positive | <0.001 |
| Memory CD4+ T cells | Positive | <0.001 |
| M2 macrophages | Positive | <0.001 |
| NK cells | Positive | 0.032 |
| Monocytes | Positive | 0.035 |
| M1 macrophages | Positive | 0.024 |
| Plasma cells | Positive | 0.007 |
| Memory B cells | Positive | 0.001 |
These correlations have been established using advanced computational methods including CIBERSORT and single-sample Gene Set Enrichment Analysis (ssGSEA) .
How does EDNRA influence cancer immunotherapy responses?
EDNRA plays a critical role in tumor immune suppression by modulating the secretion of EV PD-L1, thus affecting T cell activity and reducing the efficacy of immune checkpoint blockade therapy. Research has demonstrated that inhibiting EDNRA with drugs such as macitentan can enhance antitumor immunity and improve immunotherapy outcomes. Patients with lower EDNRA expression levels generally demonstrate superior responses to immunotherapy treatments .
What signaling pathways are associated with EDNRA in cancer?
Gene Set Enrichment Analysis has identified several key signaling pathways associated with EDNRA in cancer progression, including:
-
JAK-STAT signaling pathway
-
TGF-β signaling pathway
These pathways are critical for understanding how EDNRA influences tumor development, immune response modulation, and potential therapeutic targets .
How can EDNRA knockdown be achieved for functional studies?
Effective EDNRA knockdown for mechanistic studies can be accomplished using lentiviral shRNA vectors. Published research has successfully employed:
-
shRNA sequence 1: TCTTCATTTAAGCCGTATATT
-
shRNA sequence 2: GCTCAGGATCATTTACCAGAA
The lentiviral vector pLVX-shRNA1 with cloning sites BamHI-EcoR1 has been effectively used for EDNRA knockdown studies. This approach has demonstrated that EDNRA knockdown inhibits proliferation and migration in cancer cell lines including MDA-MB-231 and HepG2 .
What computational tools and databases are useful for EDNRA research?
Several bioinformatic resources have proven valuable for EDNRA research:
| Database/Tool | URL | Primary Application |
|---|---|---|
| TIMER | https://cistrome.shinyapps.io/timer/ | Immune infiltration analysis |
| CIBERSORT | https://cibersort.stanford.edu/ | Calculating immune cell proportions |
| TISIDB | http://cis.hku.hk/TISIDB/index.php | Tumor-immune system interactions |
| GSEA | - | Pathway enrichment analysis |
| ImmuCellAI | http://bioinfo.life.hust.edu.cn/web/ImmuCellAI/ | Immune cell infiltration estimation |
These tools enable comprehensive analysis of EDNRA's role in various cancers and immune responses .
What factors affect EDNRA antibody performance in immunostaining?
Critical factors include:
-
Fixation protocols (duration and fixative type)
-
Antigen retrieval methods (heat-induced vs. enzymatic)
-
Antibody concentration and incubation conditions
-
Detection system sensitivity
-
Sample processing and storage conditions
-
Endogenous enzyme activities interfering with detection
Optimization strategies should include testing multiple antigen retrieval methods, antibody titration, and appropriate positive and negative controls.
How can specificity of EDNRA antibodies be confirmed?
Specificity confirmation methods include:
-
Testing in tissues with known EDNRA expression patterns
-
Comparing results with multiple antibodies targeting different EDNRA epitopes
-
Using EDNRA knockout/knockdown samples as negative controls
-
Peptide competition assays to verify epitope specificity
-
Western blot analysis to confirm detection of appropriate molecular weight bands
-
Cross-validation with orthogonal detection methods (e.g., mRNA expression)
