ENHO Human

What is the ENHO gene and what protein does it encode?

ENHO (Energy Homeostasis Associated) is a gene that encodes the adropin peptide, which functions as a regulatory protein involved in energy homeostasis, adiposity, glycemia, and insulin resistance . Located on chromosome 9 in humans, this gene is also known by synonyms C9ORF165 and UNQ470 . The ENHO gene has 2,629 functional associations with various biological entities across 7 categories, including molecular profiles, functional terms, diseases, phenotypes, chemicals, cell types, and genes/proteins, extracted from 67 datasets .

Where is ENHO primarily expressed in human tissues?

ENHO is expressed in multiple tissues throughout the human body, with notable expression in the liver, brain, and adipose tissue (WAT) . According to tissue expression profiles from the Allen Brain Atlas and BioGPS databases, ENHO shows differential expression patterns across various brain regions and other tissues . This multi-tissue expression profile suggests that ENHO may have tissue-specific functions related to energy metabolism regulation.

What are the primary biological functions of the ENHO gene product?

Adropin, the protein encoded by ENHO, is primarily involved in regulating energy homeostasis through several mechanisms:

• Regulation of carbohydrate and lipid substrate oxidation preferences

• Reduction of high blood glucose levels by inhibiting hepatic glucose output

• Suppression of triglyceride accumulation via activation of the 5'-adenosine monophosphate-activated protein kinase (AMPK) pathway

• Inhibition of adipogenesis through suppression of PPARγ, C/ebpβ, and Fabp4 expression in preadipocytes

These functions collectively position adropin as a significant metabolic regulator with potential implications for obesity, diabetes, and metabolic syndrome research.

What animal models are most appropriate for studying ENHO function?

Rat models have proven particularly effective for studying ENHO function in the context of stress and energy metabolism. Experimental approaches typically utilize:

• Male Wistar rats (180-220g) maintained on balanced diets with free access to water

• Control groups compared with experimental groups under different stress conditions

• Diet-induced obesity models to investigate adropin's effects on glucose metabolism

When designing experiments with these models, researchers should consider:

What techniques are used to measure ENHO expression in different tissues?

Based on established research protocols, the following methodological approach is recommended for analyzing ENHO expression :

• Tissue Collection and Preparation:

  • Harvest liver, adipose tissue (WAT), and brain samples

  • Transfer immediately under strict freezing conditions to prevent RNA degradation

• RNA Isolation and Quality Assessment:

  • Extract total RNA using RNeasy Mini Kit (Qiagen) or equivalent

  • Verify RNA purity and concentration using spectrophotometry (NanoDrop)

• cDNA Synthesis:

  • Heat-denature RNA template

  • Convert to cDNA using First Strand cDNA Synthesis Kit

• Gene Expression Analysis:

  • Perform RT-PCR using specific ENHO primers (5′ TGCTGCTCTGGGTCATCCTCTG 3′)

  • Use appropriate housekeeping genes (e.g., actb) for normalization

  • Calculate fold change in gene expression using the 2^(-ΔΔCT) method

How can researchers accurately assess energy homeostasis in ENHO studies?

Indirect calorimetry using metabolic cage systems (e.g., PhenoMaster) provides comprehensive assessment of energy homeostasis parameters :

• Acclimatization:

  • House subjects individually in calorimetry cages

  • Discard first 6 hours of measurements to account for adaptation period

• Key Measurements:

  • Oxygen consumption (VO₂)

  • Carbon dioxide production (VCO₂)

  • Respiratory quotient (RQ = VCO₂/VO₂)

  • Total energy expenditure (TEE) in kcal/hour/kg

  • Food intake (FI) in g/day

• Calculations:

  • TEE relative to total body weight

  • TEE relative to lean body mass (estimated at 0.75% of whole-body weight)

  • RQ values to determine substrate utilization (fat vs. carbohydrate)

How does stress affect ENHO gene expression?

Research demonstrates distinct patterns of ENHO expression under different stress conditions :

These findings suggest that stress duration and intensity significantly impact ENHO regulation, with potentially different metabolic consequences depending on stress chronicity .

What is the relationship between ENHO expression and energy expenditure?

The relationship between ENHO expression and energy expenditure is complex and appears to vary with physiological context :

• In chronic stress conditions, elevated ENHO expression correlates with:

  • Increased oxygen consumption (VO₂)

  • Increased carbon dioxide production (VCO₂)

  • Higher respiratory quotient (RQ)

  • Elevated total energy expenditure (TEE)

  • Increased food intake, paradoxically accompanied by weight loss

These observations suggest that adropin may contribute to a metabolic state that promotes energy expenditure and prevents obesity despite increased caloric intake, potentially through effects on adipogenesis and substrate utilization .

How does ENHO expression correlate with corticosterone levels during stress?

Studies indicate a relationship between stress hormones and ENHO expression :

• Chronic stress exposure results in significantly elevated corticosterone levels compared to acute stress or normal conditions

• This elevation in corticosterone correlates with increased ENHO mRNA expression in liver, brain, and adipose tissue

• The relationship suggests potential regulatory connections between the HPA axis and ENHO expression

• The differential response in acute versus chronic stress suggests adaptation mechanisms may influence this relationship over time

What are the molecular mechanisms by which ENHO regulates energy metabolism?

Current evidence suggests several molecular pathways through which ENHO/adropin influences energy metabolism :

• AMPK Pathway Activation:

  • Adropin activates the 5'-adenosine monophosphate-activated protein kinase (AMPK) pathway

  • This activation inhibits hepatic glucose output and reduces triglyceride accumulation

  • AMPK serves as a cellular energy sensor and metabolic switch

• Adipogenesis Regulation:

  • Suppression of PPARγ, C/ebpβ, and Fabp4 mRNA expression in preadipocytes

  • Reduction in lipid accumulation and adipogenesis

  • Potential contribution to weight regulation despite increased food intake

• Substrate Utilization Preferences:

  • Influence on the respiratory quotient suggests adropin may regulate the balance between carbohydrate and fat oxidation

  • This may optimize energy utilization during different physiological states

What are the current challenges in ENHO human research?

Several significant challenges must be addressed in advancing ENHO research :

• Methodological Limitations:

  • Need for comprehensive body composition analysis to identify specific compartments affected by ENHO expression changes

  • Importance of simultaneous measurement of both ENHO gene expression and circulating adropin levels

  • Integration of substrate level measurements (glucose, lipids) with ENHO expression data

• Mechanistic Understanding:

  • Resolving the apparent paradox of increased food intake with weight loss in chronic stress conditions

  • Elucidating tissue-specific roles of ENHO/adropin in metabolic regulation

  • Understanding the adaptation response to sustained high ENHO expression

• Translation to Human Physiology:

  • Determining whether findings from rodent models accurately reflect human ENHO function

  • Establishing normal reference ranges for ENHO expression and adropin levels in diverse human populations

  • Identifying potential genetic variants that may influence ENHO function

What future research directions should ENHO investigators consider?

Based on current knowledge gaps, several promising research directions emerge :

• Therapeutic Potential Exploration:

  • Investigation of adropin as a potential therapeutic agent for obesity prevention

  • Analysis of adropin's role in counteracting metabolic dysregulation under chronic stress

  • Development of interventions targeting ENHO expression or adropin signaling

• Integrative Approaches:

  • Multi-omics analyses integrating transcriptomics, proteomics, and metabolomics data

  • Systems biology approaches to map ENHO/adropin's position in broader metabolic networks

  • Longitudinal studies examining ENHO expression changes over time in response to various interventions

• Clinical Relevance:

  • Examination of ENHO expression in human metabolic disorders

  • Identification of potential biomarkers related to ENHO/adropin function

  • Investigation of ENHO's role in stress-related metabolic dysfunction in humans