ENTPD8 Antibody

What is ENTPD8 and what is its primary function in cellular systems?

ENTPD8, also known as E-NTPDase 8 or liver ecto-ATP-diphosphohydrolase, belongs to the GDA1/CD39 NTPase protein family. It functions as a canalicular ectonucleoside NTPDase responsible for the main hepatic NTPDase activity. ENTPD8 catalyzes the hydrolysis of gamma- and beta-phosphate residues of nucleotides, playing a central role in regulating extracellular nucleotide concentrations . The canonical human ENTPD8 protein consists of 495 amino acid residues with a molecular mass of 53.9 kDa, though its observed molecular weight can range from 54-70 kDa depending on glycosylation state . It has specific activity toward ATP, ADP, UTP, and UDP, but not toward AMP, and catalyzes the reaction: ATP + 2 H₂O = AMP + 2 phosphate .

Where is ENTPD8 primarily expressed in human and animal tissues?

ENTPD8 shows a tissue-specific expression pattern predominantly in the gastrointestinal system. In humans, it is notably expressed in the small intestine, rectum, duodenum, colon, appendix, and liver . The protein is primarily localized to the cell membrane, where it can interact with extracellular nucleotides . Gene orthologs have been reported in multiple species including mouse, rat, bovine, frog, and chimpanzee, making it suitable for comparative studies across different experimental models .

What are the standard applications for ENTPD8 antibodies in research?

ENTPD8 antibodies are commonly employed in several key applications:

• Western Blot (WB): Typically used at dilutions of 1:500-1:2000 to detect ENTPD8 protein in cell and tissue lysates

• Immunohistochemistry (IHC): Used at dilutions of 1:50-1:500 for visualization of ENTPD8 in tissue sections

• Enzyme-Linked Immunosorbent Assay (ELISA): For quantitative determination of ENTPD8 levels

These applications enable researchers to study ENTPD8 expression patterns, localization, and potential alterations in various physiological and pathological conditions.

What are the optimal conditions for Western blot detection of ENTPD8?

For optimal Western blot detection of ENTPD8:

• Sample preparation: Dissolve cells in RIPA buffer and determine protein concentration using a BCA Protein Assay Kit

• Electrophoresis: Load approximately 50 μg of protein per sample on 4%-12% NuPAGE gels with MOPS SDS running buffer

• Transfer: Transfer to PVDF membrane using standard protocols

• Blocking: Block membrane with blocking buffer for 30 minutes at room temperature

• Primary antibody: Incubate with anti-ENTPD8 antibody (dilution 1:500-1:2000) overnight at 4°C

• Washing: Wash four times with 1× TBST

• Secondary antibody: Incubate with HRP-conjugated secondary antibody for 4 hours at room temperature

• Detection: Use electrochemiluminescent substrate for visualization

Note that ENTPD8 can appear at different molecular weights: the calculated molecular weight is 54 kDa, but the observed weight can range from 54-70 kDa due to post-translational modifications, particularly N-glycosylation .

How can researchers validate the specificity of ENTPD8 antibodies?

To validate ENTPD8 antibody specificity, researchers should implement multiple complementary approaches:

• Knockdown experiments: Use siRNA targeting ENTPD8 to create negative controls. A validated siRNA design can be implemented using BLOCK-iT RNAi Designer Software, with sequences as follows:

  siRNA	Sequence (5′-3′)
  si-ENTPD8a sense	GGAAUCUCCUCCUACACUU
  si-ENTPD8a antisense	AAGUGUAGGAGGAGAUUCC
  si-ENTPD8b sense	CCAACUUCUACUACACCUU
  si-ENTPD8b antisense	AAGGUGUAGUAGAAGUUGG
  si-NC sense (control)	GGACCUCUCCUACAUACUU
  si-NC antisense (control)	AAGUAUGUAGGAGAGGUCC

• Overexpression systems: Create positive controls by overexpressing ENTPD8 using plasmids like pcDNA3.1-ENTPD8

• qRT-PCR validation: Confirm knockdown or overexpression at the mRNA level using validated primers:

  Primer	Sequence (5′-3′)
  ENTPD8 forward	GCCTCACGGCACTCATTCTC
  ENTPD8 reverse	CGCATCAAACACGATCCCAA
  β-Actin forward	GGACTTCGAGCAAGAGATGG
  β-Actin reverse	AGCACTGTGTTGGCGTACAG

• Testing in multiple relevant cell lines: Validated cell lines include HepG2 cells, which are known to express ENTPD8

• Cross-validation with multiple antibodies: Compare results using antibodies raised against different epitopes of ENTPD8

What are the recommended protocols for immunohistochemical detection of ENTPD8?

For optimal IHC detection of ENTPD8 in tissue sections:

• Tissue preparation: Fix tissues in neutral-buffered 10% formalin solution, embed in paraffin, and section at 4 μm thickness

• Rehydration: Rehydrate sections using standard protocols

• Antigen retrieval: Two options are recommended:

  • Option 1: Use TE buffer pH 9.0 (preferred method)

  • Option 2: Use citrate buffer pH 6.0 as an alternative

• Peroxidase blocking: Incubate with 3% H₂O₂ in methanol for 10 minutes

• Serum blocking: Block with 10% goat serum for 30 minutes at room temperature

• Primary antibody: Apply ENTPD8 antibody (dilution 1:50-1:500) and incubate at 4°C overnight

• Secondary antibody: Incubate with appropriate secondary antibody at room temperature for 1 hour

• Detection: Apply peroxidase-conjugated streptavidin at 37°C for 30 minutes, then DAB for 5-10 minutes

• Counterstaining: Counterstain, dehydrate, clear with xylene, and mount with neutral gum

Positive control tissues include human normal stomach and liver tissue sections where ENTPD8 is known to be expressed .

How does ENTPD8 affect nucleotide metabolism in experimental models?

ENTPD8's role in nucleotide metabolism can be studied through several methodological approaches:

• In vitro enzymatic activity assays: Measuring ATP hydrolysis by ENTPD8-expressing cells

  • Example methodology: Add ATP solution to cultured cells expressing ENTPD8 (e.g., HEK293 cells transfected with Entpd8-expression vector) and measure remaining ATP concentration after 5 minutes using luminescence-based assays

• Metabolite analysis in ENTPD8-modified systems: For analyzing downstream metabolic effects

  • Findings show that ENTPD8 overexpression downregulates CTP levels while upregulating CMP and cytidine levels

  • ENTPD8 knockdown produces the opposite effect: increased CTP levels and decreased CMP and cytidine levels

  • This demonstrates ENTPD8's role in catalyzing the dephosphorylation of CTP to CMP in the pyrimidine metabolism pathway

• Genetic manipulation studies: Using knockout or overexpression systems

  • Entpd8⁻/⁻ (knockout) mice can be used to study physiological roles of ENTPD8

  • Cellular transfection with ENTPD8 plasmids (e.g., pcDNA3.1-ENTPD8 at 1 μg/2×10⁵ cells using Lipofectamine 2000) allows for overexpression studies

What is the role of ENTPD8 in inflammatory bowel conditions and how can it be investigated?

ENTPD8 plays an important immunomodulatory role in gut homeostasis, particularly in inflammatory conditions:

• Experimental colitis models:

  • Entpd8⁻/⁻ mice show increased susceptibility to DSS-induced colitis with higher disease activity index (DAI) scores and more severe intestinal pathology compared to wild-type mice

  • This indicates ENTPD8's protective role against colitis

• Immunological analysis methodologies:

  • Flow cytometry analysis of large intestinal lamina propria reveals increased accumulation of IL-17⁺ CD4⁺ T cells, neutrophils, and CD64⁻CD11b⁺Ly6C⁺ dendritic cells in Entpd8⁻/⁻ mice after DSS administration

  • Gene expression analysis shows higher levels of Il17a and Mpo in colonic tissue of Entpd8⁻/⁻ mice

• Mechanistic studies:

  • ENTPD8 hydrolyzes luminal ATP, which acts as a damage-associated molecular pattern (DAMP) to prevent innate intestinal pathology

  • Combination of Entpd8⁻/⁻ with other genetic models (e.g., Entpd8⁻/⁻Rag2⁻/⁻ mice) helps delineate the role of different immune compartments

  • Cell depletion studies using anti-CD4 or anti-Gr-1 antibodies in Entpd8⁻/⁻ mice help identify key cellular mediators

• Clinical relevance:

  • ENTPD8 expression is severely reduced in epithelial cells of patients with ulcerative colitis, suggesting potential therapeutic implications

How does ENTPD8 influence cancer cell phenotypes and what experimental approaches reveal these effects?

Research has demonstrated ENTPD8's role in cancer biology, particularly in pancreatic cancer:

• Cell viability assays:

  • CCK-8 assay reveals that ENTPD8 overexpression weakens pancreatic cancer cell viability while ENTPD8 knockdown strengthens it

  • Significant differences between control and ENTPD8-modified cells become apparent at 72 hours post-transfection

• Apoptosis assessment:

  • Flow cytometry analysis with Annexin V/PI staining shows increased apoptosis in ENTPD8-overexpressing pancreatic cancer cells

  • ENTPD8 knockdown reduces apoptosis, suggesting a tumor-suppressive role

• Combined approaches to investigate mechanisms:

  • Cell metabolite analysis correlates ENTPD8 expression with changes in nucleotide metabolism (CTP, CMP, cytidine levels)

  • Gene expression analysis using qRT-PCR with specific primers:

    Primer	Sequence (5′-3′)
    ENTPD8 forward	GCCTCACGGCACTCATTCTC
    ENTPD8 reverse	CGCATCAAACACGATCCCAA

  • Protein analysis through Western blotting with ENTPD8 antibodies

• Experimental design considerations:

  • Use multiple pancreatic cancer cell lines (e.g., PANC-1, CFPAC-1) for validation

  • Include appropriate controls: scrambled siRNA (si-NC) and empty vectors

  • Evaluate both knockdown and overexpression to establish causality

What considerations are important when selecting ENTPD8 antibodies for specific research applications?

When selecting ENTPD8 antibodies for specific research applications, consider:

• Target species and cross-reactivity:

  • Available antibodies show different reactivity profiles:

    • Human-specific antibodies

    • Multi-species reactive antibodies (human, mouse, rat, etc.)

  • Verify reported cross-reactivity with your experimental model species

• Application-specific characteristics:

  • For Western blot: Consider antibodies validated at 1:500-1:2000 dilutions

  • For IHC: Select antibodies validated at 1:50-1:500 dilutions with specific buffers for antigen retrieval

  • For multiplex applications: Consider unconjugated antibodies that can be paired with secondary detection systems

• Epitope specificity:

  • N-terminal region antibodies may detect specific isoforms

  • C-terminal antibodies might be useful for detecting full-length protein

  • Consider post-translational modifications that might affect epitope recognition, particularly N-glycosylation

• Validation data requirements:

  • Check for published citations demonstrating antibody use in similar applications

  • Review validation data in relevant cell lines (e.g., HepG2 cells) or tissues (liver, intestinal tissues)

  • Consider antibodies with orthogonal validation through RNAseq or other complementary methods

• Storage and handling considerations:

  • Most ENTPD8 antibodies are supplied in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3

  • Typically store at -20°C with stability for one year after shipment

  • Some formulations contain BSA (0.1%) which may be relevant for certain applications

How might ENTPD8 function be linked to gut microbiome interactions and what methodologies can explore this relationship?

While direct evidence linking ENTPD8 to microbiome interactions is still emerging, several methodological approaches can be used to investigate this relationship:

• Gnotobiotic studies with Entpd8⁻/⁻ mice:

  • Compare germ-free versus colonized Entpd8⁻/⁻ mice in colitis models

  • Analyze how microbiome composition affects ENTPD8-mediated protection against intestinal inflammation

  • Use 16S rRNA sequencing to characterize microbial communities

• Metabolomic analyses:

  • Investigate how ENTPD8-mediated ATP hydrolysis affects nucleotide availability for gut bacteria

  • Examine potential cross-feeding relationships between host ENTPD8 activity and bacterial metabolism

  • Correlate ENTPD8 expression/activity with bacterial metabolite profiles in experimental colitis

• Co-culture systems:

  • Establish intestinal epithelial cell models with modulated ENTPD8 expression

  • Examine interactions with various bacterial strains under controlled conditions

  • Measure ATP levels, bacterial adherence, and epithelial responses

These approaches could provide insights into how ENTPD8's role in ATP hydrolysis and immunomodulation might influence the host-microbiome relationship in health and disease.

What are the most effective genetic manipulation approaches for studying ENTPD8 function in complex disease models?

For studying ENTPD8 function in complex disease models, several genetic manipulation strategies are particularly effective:

• Tissue-specific conditional knockout models:

  • Generate floxed Entpd8 mice crossed with tissue-specific Cre lines (intestinal epithelium, hepatocytes)

  • Enables temporal control of ENTPD8 deletion using inducible Cre systems

  • Allows investigation of tissue-specific ENTPD8 functions while avoiding developmental compensation

• CRISPR/Cas9-mediated genome editing:

  • Generate precise point mutations or domain deletions in ENTPD8

  • Create reporter knock-in models to track ENTPD8 expression

  • Design strategies for both cell culture and in vivo applications

• AAV-mediated gene delivery:

  • Deliver ENTPD8 expression constructs to specific tissues in adult animals

  • Rescue ENTPD8 function in knockout models

  • Overexpress ENTPD8 in disease contexts to assess therapeutic potential

• Combined genetic approaches for mechanistic studies:

  • Cross Entpd8⁻/⁻ mice with other disease-relevant knockout models (as demonstrated with Entpd8⁻/⁻Rag2⁻/⁻ mice)

  • Implement genetic labeling of ENTPD8-expressing cells for lineage tracing

  • Use genetic reporters for ATP sensing to correlate with ENTPD8 activity

These approaches provide powerful tools for dissecting ENTPD8 function in complex physiological contexts while controlling for developmental and compensatory mechanisms.

What potential roles might ENTPD8 play in metabolic disorders beyond its established functions?

Based on its enzymatic activity and tissue distribution, ENTPD8 may have unexplored roles in metabolic disorders:

• Potential involvement in NAFLD/NASH:

  • Given ENTPD8's expression in liver and role as the "main hepatic NTPDase"

  • ATP metabolism dysregulation is implicated in liver pathology

  • Research direction: Compare ENTPD8 expression and activity in liver samples from patients with various stages of fatty liver disease

• Intestinal barrier function in metabolic syndrome:

  • ENTPD8's expression throughout the intestinal tract suggests potential roles in intestinal permeability

  • ATP signaling affects tight junction integrity

  • Research approach: Examine intestinal permeability in Entpd8⁻/⁻ mice on high-fat diets

• Nucleotide metabolism in diabetes:

  • Purinergic signaling is altered in pancreatic islets during diabetes progression

  • ENTPD8's role in pyrimidine metabolism may affect insulin secretion pathways

  • Experimental model: Conditional deletion of Entpd8 in β-cells or intestinal L-cells

Research methods to explore these hypotheses would include targeted metabolomics, tissue-specific genetic models, and detailed phenotyping for metabolic parameters.

How might post-translational modifications of ENTPD8 be studied and what functional significance might they have?

ENTPD8 undergoes post-translational modifications, particularly N-glycosylation, which may significantly affect its function:

• Analytical approaches for studying ENTPD8 glycosylation:

  • Enzymatic deglycosylation with PNGase F and comparison of molecular weight shifts by Western blot (from 70-85 kDa glycosylated to 54 kDa deglycosylated)

  • Mass spectrometry analysis to identify specific glycosylation sites and glycan structures

  • Site-directed mutagenesis of predicted N-glycosylation sites followed by functional analysis

• Potential functional significance:

  • Glycosylation may affect ENTPD8 trafficking to the cell membrane

  • Modifications could alter substrate specificity or enzymatic activity

  • Glycan structures might mediate protein-protein interactions

• Methodological approaches to correlate modifications with function:

  • Generate glycosylation-deficient mutants and assess enzymatic activity, stability, and localization

  • Compare glycosylation patterns across tissues and disease states

  • Employ inhibitors of specific glycosylation pathways to assess effects on ENTPD8 function