ERO1LB Antibody

What is ERO1LB and what is its functional role in cellular processes?

ERO1LB (ERO1-like protein beta, also known as ERO1B or ERO1-L-beta) is an essential oxidoreductase involved in disulfide bond formation in the endoplasmic reticulum (ER). It functions by efficiently reoxidizing P4HB/PDI (protein disulfide isomerase), which is the enzyme catalyzing protein disulfide formation, allowing P4HB to sustain additional rounds of disulfide formation .

ERO1LB is particularly important in the following processes:

• Maintaining redox homeostasis within the ER

• Regulating the unfolded protein response (UPR) pathway

• Preventing accumulation of misfolded proteins

• May be involved in oxidative proinsulin folding in pancreatic β-cells

Following P4HB reoxidation, ERO1LB passes its electrons to molecular oxygen via FAD, leading to the production of reactive oxygen species (ROS) in the cell, which contributes to its role in glucose homeostasis .

What applications can ERO1LB antibodies be used for in research settings?

ERO1LB antibodies have been validated for multiple applications in molecular and cellular biology research:

Researchers should note that optimal dilutions may vary depending on the specific antibody, sample type, and experimental conditions. It is recommended to perform a titration experiment to determine optimal concentrations for each application .

What is the observed molecular weight of ERO1LB in different experimental systems?

The molecular weight of ERO1LB can vary between predicted and observed values:

When performing Western blotting, researchers should be aware that variations in observed molecular weight may occur due to:

• Post-translational modifications

• Tissue-specific processing

• Experimental conditions (reducing vs. non-reducing)

• Different gel systems and running conditions

How should ERO1LB antibodies be stored and handled for optimal performance?

For optimal performance and longevity of ERO1LB antibodies, follow these storage and handling recommendations:

Some vendor-specific antibodies may contain BSA (0.1%) in small volume formats, which should be noted for experiments where BSA might interfere .

How can ERO1LB antibodies be used to investigate ER stress and the unfolded protein response (UPR)?

ERO1LB plays a critical role in ER stress and UPR pathways, making its detection valuable for studying these processes:

Methodological approach for ERO1LB in ER stress studies:

• Expression pattern analysis:

  • Use Western blotting to quantify ERO1LB upregulation during ER stress induced by thapsigargin, tunicamycin, or DTT

  • ERO1LB levels are induced by high glucose concentrations and reducing agents like dithiothreitol (DTT), indicating its role in adaptation to increased oxidative protein folding load

• Co-immunoprecipitation studies:

  • Use ERO1LB antibodies to precipitate protein complexes and identify interaction partners during ER stress

  • ERO1LB interacts with PDI and ERO1A to maintain redox homeostasis

• Subcellular localization:

  • Use immunofluorescence with ERO1LB antibodies to track changes in localization during ER stress

  • Can be combined with other ER stress markers (e.g., BiP/HSPA5) for colocalization studies

• Functional studies:

  • siRNA knockdown of ERO1LB increases susceptibility to ER stress-induced apoptosis, demonstrating its protective role

  • Monitor changes in expression following treatment with chemical chaperones like TUDCA and 4-PBA

Research has shown that ERO1LB is regulated by PDX1, a key transcription factor in pancreatic β-cells, and PDX1 deficiency reduced ERO1LB transcript levels in mouse islets and mouse insulinoma (MIN6) cells .

What is the role of ERO1LB in diabetes research and how can antibodies help elucidate this connection?

ERO1LB has been implicated in diabetes pathophysiology, particularly in relation to pancreatic β-cell function and insulin processing:

Experimental approaches for diabetes research using ERO1LB antibodies:

• Pancreatic tissue analysis:

  • IHC studies reveal ERO1LB expression in pancreatic tissues, with positive detection in human pancreas cancer tissue and normal pancreas

  • ERO1LB may be involved in oxidative proinsulin folding in pancreatic cells, impacting glucose homeostasis

• Animal models:

  • In the Akita mouse model of diabetes, ER stress affects β-cell mass expansion and differentiation

  • ERO1LB antibodies can be used to track expression changes in these models

• Mechanistic studies:

  • siRNA silencing of ERO1LB decreases insulin content and increases susceptibility to ER stress-induced apoptosis

  • Western blot analysis comparing ERO1LB levels between wild-type and Akita mice can reveal regulation during diabetes progression

• Lineage tracing studies:

  • Combined with genetic reporting systems (like RIP-Cre:Rosa26-Yfp reporter mice), ERO1LB antibodies can help monitor β-cell fate in diabetes models

Research has shown that during the neonatal period in Akita mice, exposure to ER stress dramatically reduces β-cell growth and functional maturation, with changes in expression of ER stress-related genes including those involved in the oxidative protein folding machinery .

How can researchers optimize immunohistochemistry protocols for ERO1LB detection in different tissue types?

Optimizing immunohistochemistry (IHC) for ERO1LB requires consideration of tissue-specific factors:

Detailed IHC optimization protocol for ERO1LB detection:

• Antigen retrieval methods:

  • For human pancreas, esophagus, and small intestine tissues: TE buffer pH 9.0 is recommended

  • Alternative: citrate buffer pH 6.0 can be used if TE buffer yields suboptimal results

• Antibody dilution ranges:

  • Start with 1:20-1:200 dilution range for most tissue types

  • For pancreatic tissue specifically, which expresses higher levels of ERO1LB, begin with 1:50-1:100 dilution

• Detection systems:

  • For low expression tissues: Use amplification systems like tyramide signal amplification

  • For co-localization studies: Consider fluorescent secondaries for multi-channel imaging

• Positive control tissues:

  • Human pancreas tissue (high expression)

  • Human placenta tissue (moderate expression)

  • Human brain tissue (detected in Western blot)

• Counterstaining:

  • For brightfield IHC: Hematoxylin counterstain

  • For fluorescent IHC: DAPI for nuclear counterstain

For best results, it is recommended to titrate the antibody in each testing system, as ERO1LB expression can be sample-dependent and vary between tissue types .

What are the best approaches for validating ERO1LB antibody specificity for critical research applications?

Thorough validation of ERO1LB antibody specificity is essential for reliable research results:

Comprehensive antibody validation strategy:

• Knockout/knockdown controls:

  • Use siRNA or CRISPR-Cas9 systems to reduce ERO1LB expression

  • Compare antibody signal between control and KD/KO samples

  • Published KD/KO validation data is available for some commercial antibodies

• Multiple antibody approach:

  • Use antibodies from different vendors or raised against different epitopes

  • Confirm consistent expression patterns with antibodies targeting different regions:

    • C-terminal specific antibodies (e.g., ab230540)

    • Antibodies against recombinant fragments (aa 250-450)

    • Peptide-raised antibodies (aa 250-300)

• Blocking peptide experiments:

  • Pre-incubate antibody with immunizing peptide before application

  • Signal should be significantly reduced if antibody is specific

  • Some vendors offer matching blocking peptides for purchase

• Cross-species reactivity testing:

  • Test in multiple species with known sequence homology

  • Human ERO1LB shares high sequence identity with:

    • Mouse ERO1LB (92% identity)

    • Rat ERO1LB (93% identity)

• Western blot analysis:

  • Confirm single band at expected molecular weight (54 kDa)

  • Observe band pattern across different tissues and cell lines

By employing multiple validation approaches, researchers can ensure their results accurately reflect ERO1LB biology rather than non-specific antibody binding.

How does ERO1LB expression change during cellular stress conditions and how can this be effectively measured?

ERO1LB expression is dynamically regulated during various cellular stress conditions:

Experimental design for measuring stress-induced changes:

• ER stress induction protocols:

  • Chemical inducers:

    • Thapsigargin (low-dose): Depletes ER calcium stores

    • Dithiothreitol (DTT, 1mM): Creates reducing conditions

    • Tunicamycin: Blocks N-linked glycosylation

• Time-course experiments:

  • For DTT treatment: Collect samples at 0, 1, 2, 4, and 6 hours

  • For chronic stress: Monitor expression changes over 24-72 hours

  • Use both RNA (RT-PCR) and protein (Western blot) analysis

• Transcriptional vs. post-transcriptional regulation:

  • Measure mRNA stability using actinomycin D (10 μg/ml)

  • Assess protein half-life using cycloheximide chase experiments

• Quantitative analysis methods:

  • RT-qPCR for transcript levels

  • Western blot with densitometry for protein levels

  • Immunofluorescence with quantitative image analysis for cellular localization

Research has shown that ERO1LB is upregulated during ER stress and can be regulated by PDX1, a key transcription factor in pancreatic β-cells. During PDX1 silencing, a 57% reduction in ERO1LB transcript levels was observed, with corresponding reduction in protein levels .

What are the key differences between polyclonal and monoclonal ERO1LB antibodies for research applications?

When selecting between polyclonal and monoclonal ERO1LB antibodies, consider these comparative factors:

How can ERO1LB antibodies be used to distinguish between the alpha and beta isoforms of ERO1L in experimental systems?

Distinguishing between ERO1LB and its homolog ERO1LA requires careful antibody selection and experimental design:

Strategic approach for isoform-specific detection:

• Epitope selection:

  • Choose antibodies raised against regions with minimal sequence homology between ERO1LA and ERO1LB

  • C-terminal regions often show greater divergence between isoforms

• Validation in overexpression systems:

  • Test antibody against cells overexpressing either ERO1LA or ERO1LB specifically

  • Confirm absence of cross-reactivity with the non-target isoform

• Tissue-specific expression patterns:

  • ERO1LB is enriched in pancreatic tissues while ERO1LA is more ubiquitously expressed

  • Use pancreatic tissue as a positive control for ERO1LB-specific antibodies

• Dual-labeling approaches:

  • Perform co-staining with antibodies against both isoforms

  • Use different host species or directly conjugated antibodies to avoid cross-reactivity

  • Analyze colocalization patterns to distinguish shared vs. distinct functions

• Functional studies:

  • ERO1LA and ERO1LB can form both homodimers and mixed heterodimers

  • Use co-immunoprecipitation with isoform-specific antibodies to study these interactions

Research has shown that mammals express these two related Ero proteins (ERO1LA and ERO1LB), which despite their homology, have distinct tissue expression patterns and potentially specialized functions in different cell types .

What experimental controls should be included when performing Western blot analysis with ERO1LB antibodies?

Rigorous Western blot experiments with ERO1LB antibodies should include these essential controls:

Comprehensive control strategy for Western blotting:

• Positive controls:

  • Cell/tissue types with confirmed ERO1LB expression:

    • HeLa cells and human placenta tissue

    • Human brain tissue, mouse brain tissue, rat brain tissue

    • Pancreatic tissue or β-cell lines (high expression)

• Negative controls:

  • Primary antibody omission control

  • Non-specific IgG from same species as ERO1LB antibody

  • Knockdown/knockout samples if available

• Loading controls:

  • Standard housekeeping proteins (β-actin, GAPDH)

  • Include phosphorylated protein controls when studying stress conditions

• Molecular weight markers:

  • Include markers that span the expected range (54 kDa for ERO1LB)

  • Be aware that observed molecular weight may range from 40-50 kDa in some systems

• Antibody concentration titration:

  • Test multiple dilutions (recommended range: 1:500-1:3000)

  • Determine optimal concentration for specific sample types

• Sample preparation controls:

  • Compare reducing vs. non-reducing conditions

  • Include positive control for ER stress when studying stress response

By incorporating these controls, researchers can ensure the specificity of their ERO1LB detection and improve the reproducibility of their Western blot results.

How can ERO1LB antibodies be effectively used in multiplex immunofluorescence experiments to study ER stress pathways?

Multiplex immunofluorescence with ERO1LB antibodies enables simultaneous visualization of multiple ER stress pathway components:

Detailed multiplex immunofluorescence protocol:

• Panel design for ER stress studies:

  • ERO1LB: Marker for oxidative protein folding

  • BiP/HSPA5: General ER stress marker (upregulated in Akita islets)

  • PDI/P4HB: ERO1LB interaction partner

  • PDX1: Transcriptional regulator of ERO1LB

  • CHOP/DDIT3: Terminal UPR marker (upregulated in Akita islets)

• Antibody selection criteria:

  • Choose primary antibodies from different host species

  • If using same species, consider directly conjugated primaries

  • For rabbit polyclonal ERO1LB antibodies, pair with mouse monoclonals for other targets

• Sequential staining approach:

  • For difficult combinations:

    1. Stain with first primary and secondary antibody

    2. Block with excess unconjugated Fab fragments

    3. Continue with next primary-secondary pair

• Dilution optimization:

  • For ERO1LB antibodies: 1:50-1:500 for IF/ICC applications

  • May require higher concentrations in multiplex settings

• Controls for multiplex staining:

  • Single-color controls for spectral unmixing

  • Fluorescence-minus-one (FMO) controls to assess bleed-through

  • Combined primary antibodies with single secondary antibody controls

This approach has been successfully used to study the relationship between ER stress, β-cell differentiation, and function in models like the Akita mouse, revealing interactions between pathways regulating ER stress response and cellular identity .

What are common troubleshooting strategies for weak or non-specific ERO1LB antibody signals in various applications?

When encountering signal issues with ERO1LB antibodies, consider these application-specific troubleshooting approaches:

Western Blot Issues:

Immunohistochemistry Issues:

Immunofluorescence Issues:

For particularly challenging applications, consider alternative detection methods such as proximity ligation assay (PLA) to visualize ERO1LB interactions with binding partners.

How can researchers use ERO1LB antibodies to investigate the role of oxidative protein folding in disease models?

ERO1LB antibodies provide powerful tools for studying oxidative protein folding in disease contexts:

Methodological approaches for disease-focused studies:

• Diabetes research applications:

  • Compare ERO1LB expression in pancreatic sections from diabetic vs. healthy subjects

  • Correlate ERO1LB levels with markers of β-cell stress and dysfunction

  • In Akita mice, ERO1LB detection helps analyze how ER stress affects β-cell mass expansion and differentiation

• Cancer research applications:

  • ERO1LB detection in human pancreatic cancer tissue has been validated

  • Study correlation between ERO1LB expression and cancer progression/metastasis

  • Investigate connection between ER stress adaptation and tumor survival

• Neurodegenerative disease applications:

  • ERO1LB is detected in brain tissues from humans, mice, and rats

  • Analyze changes in oxidative folding capacity in models of protein misfolding diseases

  • Correlate with aggregation of disease-associated proteins

• Drug development applications:

  • Screen compounds that modulate ERO1LB activity or expression

  • Use ERO1LB antibodies to assess efficacy of chemical chaperones (e.g., TUDCA, 4-PBA)

  • Monitor changes in oxidative folding capacity following therapeutic interventions

• Patient-derived sample analysis:

  • Apply IHC to analyze ERO1LB expression in patient biopsies

  • Correlate with clinical parameters and disease progression

  • Develop potential diagnostic/prognostic biomarkers based on ERO1LB expression patterns

These approaches have revealed that ERO1LB plays critical roles in maintaining insulin content and regulating cell survival during ER stress, with implications for various diseases involving protein misfolding and ER dysfunction .

What techniques can be used to study post-translational modifications of ERO1LB using available antibodies?

Studying post-translational modifications (PTMs) of ERO1LB requires specialized approaches:

Technical strategies for PTM analysis:

• Phosphorylation studies:

  • Use phospho-specific antibodies (if available)

  • Otherwise, employ these methods with standard ERO1LB antibodies:

    • Immunoprecipitate with ERO1LB antibody, then probe with phospho-specific detection

    • Use phosphatase treatment of parallel samples to confirm phosphorylation

• Disulfide bond analysis:

  • Compare reducing vs. non-reducing gels to identify intramolecular disulfides

  • Use diagonal 2D electrophoresis (non-reducing first dimension, reducing second dimension)

  • Particularly relevant for ERO1LB given its role in disulfide bond formation

• Glycosylation detection:

  • Treat samples with glycosidases before Western blotting

  • Compare mobility shifts to identify glycosylated species

  • Sequential deglycosylation to characterize glycan complexity

• Ubiquitination analysis:

  • Co-IP with ERO1LB antibody followed by ubiquitin detection

  • Use proteasome inhibitors to enhance detection of ubiquitinated species

  • Compare molecular weight shifts to identify mono- vs. poly-ubiquitination

• Oxidation state analysis:

  • Use alkylating agents to trap redox states before lysis

  • AMS or NEM modification to distinguish reduced/oxidized cysteines

  • Critical for understanding ERO1LB catalytic cycle and regulation

These approaches can help researchers understand how ERO1LB activity is regulated and how its function in oxidative protein folding may be modulated during normal physiology and disease states.

How can ChIP-seq experiments with transcription factor antibodies be used to understand the regulation of ERO1LB expression?

Chromatin immunoprecipitation sequencing (ChIP-seq) provides insights into transcriptional regulation of ERO1LB:

Comprehensive ChIP-seq experimental design:

• Targeting relevant transcription factors:

  • PDX1: Confirmed regulator of ERO1LB expression

  • Methods:

    • Use validated PDX1 antibodies (e.g., Santa Cruz antibody)

    • Focus on regions with putative PDX1 binding sites in the ERO1LB promoter

    • Specific primers for ChIP verification:

      • Region 1: Forward GTTCACCCATGCTCAGTTCC; Reverse GACAGGTGGTGAGGCATGAT

      • Region 2: Forward GTTCCCTAGCCTCATGTTCC; Reverse GTGAGTCCATCCGTCATGTG

      • Region 3: Forward GGGCGTGATCATAACTGAGG; Reverse CAGCAGCGACTGATGTACCA

      • Region 4: Forward ACGAGCTGTCACTGTCATCCT; Reverse GGCAGCTCAGTCAGGAAAAG

• ER stress-responsive transcription factors:

  • ATF6, XBP1, and ATF4 are key UPR transcription factors

  • Analyze binding patterns under normal vs. ER stress conditions

  • Correlate with changes in ERO1LB expression

• Confirmation strategies:

  • Electrophoretic mobility shift assay (EMSA):

    • Using in vitro translated PDX1 with labeled oligonucleotide probes

    • Probe sequences:

      • 2A: Forward CTACAGATTAGAGCCTGGT; Reverse ACCAGGCTCTAATCTGTAG

      • 2B: Forward AGTAACAGATCATCTGTACT; Reverse AGTACAGATGATCTGTTACT

      • 2C: Forward TCAATGGGAAATCATCACTG; Reverse CAGTGATGATTTCCCATTGA

      • 2D: Forward GTACTAATTGACAAAAATTGGT; Reverse ACCAATTTTTGTCAATTAGTAC

    • Use PDX1 antiserum to produce supershifted band confirming specificity

• Functional validation:

  • Reporter gene assays with wild-type and mutated promoter regions

  • CRISPR-Cas9 editing of identified binding sites

  • Correlation with ERO1LB protein levels by Western blotting

Research has demonstrated that PDX1 silencing causes a significant 57% reduction in ERO1LB transcript levels in mouse insulinoma cells and islets from PDX1+/- mice, confirming direct regulation of ERO1LB expression by this transcription factor .

What are the emerging single-cell techniques that can utilize ERO1LB antibodies for studying cellular heterogeneity?

Single-cell approaches with ERO1LB antibodies offer new insights into cellular heterogeneity:

Cutting-edge single-cell methodologies:

• Single-cell protein analysis:

  • Mass cytometry (CyTOF):

    • Metal-conjugated ERO1LB antibodies

    • Multiparameter analysis with other ER stress markers

    • Advantage: No spectral overlap issues compared to flow cytometry

  • Single-cell Western blotting:

    • Microfluidic platforms for protein separation from individual cells

    • ERO1LB detection at single-cell resolution

    • Quantification of expression level heterogeneity

• Spatial analysis techniques:

  • Imaging mass cytometry:

    • Metal-labeled ERO1LB antibodies on tissue sections

    • Spatial mapping of expression relative to tissue architecture

    • Especially valuable for heterogeneous tissues like pancreatic islets

  • Multiplexed ion beam imaging (MIBI):

    • Higher resolution than traditional imaging mass cytometry

    • Can be combined with ultrastructural analysis

• Combined protein-RNA detection:

  • CITE-seq (Cellular Indexing of Transcriptomes and Epitopes by Sequencing):

    • Oligonucleotide-labeled ERO1LB antibodies

    • Simultaneous protein detection and transcriptome analysis

    • Correlate protein levels with gene expression programs

  • Proximity ligation in situ hybridization (PLISH):

    • Detect ERO1LB protein and mRNA in the same cell

    • Study post-transcriptional regulation mechanisms

• Dynamic single-cell imaging:

  • Live-cell imaging with anti-ERO1LB Fab fragments

    • Monitor real-time changes during ER stress response

    • Requires cell-permeable antibody fragments or live-cell compatible labeling strategies

These emerging technologies enable researchers to move beyond population averages and understand how individual cells within a tissue respond to ER stress, with potential applications in understanding disease heterogeneity and treatment response variability.