fam83d Antibody

What is FAM83D and why is it important in cellular research?

FAM83D is a protein that localizes to the mitotic spindle and plays a crucial role in proper spindle positioning and timely cell division. It functions through recruiting CK1α (casein kinase 1 alpha) to the spindle apparatus, which is essential for error-free progression through mitosis in mammalian cells . FAM83D has gained significant attention due to its upregulation in various cancers and its involvement in critical cellular processes including proliferation, migration, and apoptosis regulation . Understanding its function is important for elucidating mechanisms of cancer progression and identifying potential therapeutic targets.

What are the key cellular interactions of FAM83D that researchers should be aware of?

FAM83D has several important protein interactions that researchers should consider when designing experiments:

• It specifically interacts with CK1α during mitosis, which appears to be a regulated interaction that occurs robustly only in mitotic cell extracts

• It associates with the microtubule-associated protein HMMR (hyaluronan-mediated motility receptor, also known as RHAMM or CD168), which facilitates its recruitment to the mitotic spindle

• Other known interactors include DYNLL1 (dynein light chain 1) and BACH1 (transcription factor BTB domain and CNC homolog 1)

• In cancer research contexts, FAM83D has been shown to interact with pathways including AKT/Wnt/β-catenin signaling

How does FAM83D expression vary across different cancer types?

FAM83D expression is significantly upregulated in multiple cancer types compared to normal tissues. Analysis of The Cancer Genome Atlas (TCGA) data has revealed particularly high expression in:

• Breast cancer (BRCA) with an area under the curve (AUC) of 0.949

• Cervical cancer (CESC) with an AUC of 0.968

• Glioblastoma (GBM) with an AUC of 0.947

• Liver hepatocellular carcinoma (LIHC) with an AUC of 0.946

• Lung squamous cell carcinoma (LUSC) with an AUC of 0.990

This consistent upregulation across diverse cancer types suggests FAM83D may have fundamental roles in tumor biology that transcend tissue-specific contexts.

What criteria should be used when selecting a FAM83D antibody for research applications?

When selecting a FAM83D antibody, researchers should consider:

• Antibody specificity: Validated antibodies that specifically recognize FAM83D without cross-reactivity to other FAM83 family members (FAM83A-H) are essential

• Application compatibility: Ensure the antibody is validated for your specific application (Western blot, immunoprecipitation, immunofluorescence, etc.)

• Species reactivity: Confirm compatibility with your experimental model (human, mouse, etc.)

• Epitope location: Consider antibodies targeting different regions of FAM83D, particularly if studying truncated variants or when epitopes might be masked by protein interactions

• Validation methods: Check for antibody validation through multiple techniques, particularly knockdown/knockout experiments that demonstrate specificity

How can researchers validate the specificity of FAM83D antibodies in their experimental systems?

To validate FAM83D antibody specificity:

• Perform knockdown experiments using siRNA or shRNA targeting FAM83D (as demonstrated in studies using si-FAM83D-1, si-FAM83D-2, or sh1-FAM83D, sh2-FAM83D constructs) and confirm reduced signal in Western blot or immunofluorescence

• Use FAM83D knockout cells as a negative control (FAM83D-/- cells show complete absence of signal)

• Compare antibody detection in cells with endogenous versus overexpressed FAM83D (using pcDNA-FAM83D or similar constructs)

• Verify antibody specificity through size comparison in Western blot (FAM83D is approximately 64 kDa)

• Evaluate cell cycle-dependent signals, as FAM83D shows distinct localization and expression patterns during mitosis versus interphase

What is the optimal protocol for detecting FAM83D using Western blotting?

For optimal Western blot detection of FAM83D:

• Sample preparation:

  • Dissolve total protein in RIPA lysis buffer containing 10% protease inhibitor cocktail

  • For cell cycle-specific analysis, synchronize cells or isolate mitotic populations using nocodazole treatment followed by shake-off

  • Quantify protein concentration using bicinchoninic acid (BCA) method

• Gel electrophoresis and transfer:

  • Use standard SDS-PAGE protocols with 8-10% gels to ensure good separation in the 60-70 kDa range

  • Transfer to PVDF or nitrocellulose membranes using standard protocols

• Antibody incubation:

  • Block membranes with 5% non-fat milk or BSA

  • Use anti-FAM83D primary antibody at 1:1,000 dilution (adjust based on specific antibody characteristics)

  • Include appropriate loading controls (β-actin at 1:5,000 is commonly used)

• Detection considerations:

  • Be aware that FAM83D shows a phospho-mobility shift during mitosis, appearing as a higher molecular weight band

  • Use Image J or similar software for relative protein quantification

What approaches are most effective for studying FAM83D localization in cells?

For studying FAM83D localization:

• Immunofluorescence microscopy:

  • Fix cells with 4% paraformaldehyde or methanol

  • Use validated anti-FAM83D antibodies (typically 1:100-1:500 dilution)

  • Include co-staining for mitotic markers (e.g., α-tubulin for spindle visualization)

  • Pay particular attention to mitotic cells, as FAM83D shows distinct spindle localization during this phase

• FAM83D-GFP fusion proteins:

  • GFP-tagged FAM83D constructs allow for live-cell imaging of protein dynamics

  • Validate that tagging doesn't interfere with protein function or localization

  • Consider knockin approaches to maintain endogenous expression levels

• Super-resolution microscopy:

  • For detailed analysis of FAM83D colocalization with spindle components

  • Particularly useful for studying interactions with HMMR, CK1α, and other binding partners

What genetic manipulation strategies are most effective for studying FAM83D function?

Effective genetic manipulation strategies include:

• siRNA knockdown:

  • Multiple siRNA constructs should be tested (e.g., si-FAM83D-1, si-FAM83D-2, si-FAM83D-3)

  • Validate knockdown efficiency using Western blot and qRT-PCR

  • Analyze effects on proliferation, migration, and apoptosis

• shRNA stable knockdown:

  • Lentiviral delivery of shRNA constructs (e.g., sh1-FAM83D: GATCTGAAAGTTCATCCTGAA and sh2-FAM83D: CCTGACTTTGTCACCTTTGTT)

  • Select transduced cells using puromycin

  • Confirm knockdown using qRT-PCR with appropriate primers (e.g., forward: 5′-AGAGCGGCAATTCCACTTCG-3′, reverse: 5′-TGCCAGAATGAAGGCCAAGG-3′)

• CRISPR/Cas9 knockout:

  • Generate FAM83D-/- cell lines as complete loss-of-function models

  • Verify knockout by sequencing and protein expression analysis

• Rescue experiments:

  • After knockout, reintroduce wild-type or mutant FAM83D using polycistronic cassettes

  • This approach allows for the specific analysis of protein domains and interaction sites

How can researchers investigate the cell cycle-dependent interactions of FAM83D?

To investigate cell cycle-dependent interactions:

• Synchronization protocols:

  • Use nocodazole treatment followed by release to enrich for mitotic cells

  • Alternative: Eg5 inhibitor S-trityl L-cysteine (STLC) to induce monopolar spindle formation and mitotic arrest

• Co-immunoprecipitation (co-IP) approaches:

  • Compare IPs from asynchronous versus mitotic cell extracts

  • Use either endogenous FAM83D antibodies or GFP-trap for FAM83D-GFP constructs

  • Follow with mass spectrometry analysis to identify differential interactors

• Proximity-based labeling:

  • BioID or TurboID fusion proteins to identify proximal proteins in different cell cycle stages

  • APEX-based approaches for temporal resolution of interactions

• Fluorescence resonance energy transfer (FRET):

  • To study direct protein-protein interactions in live cells

  • Particularly useful for analyzing dynamic FAM83D-CK1α interactions during mitosis

What approaches should be used to study the role of FAM83D in cancer progression?

For studying FAM83D in cancer progression:

• In vitro functional assays after manipulation of FAM83D expression:

  • Proliferation assays: CCK-8 or MTT assays to measure cell viability (2×10³ cells per well in 96-well plates)

  • Migration assays: Scratch-healing assays and Boyden chamber transwell assays (1×10⁴ cells)

  • Invasion assays: Matrigel-coated transwell chambers

  • Apoptosis assays: Annexin V-PE flow cytometry and analysis of apoptotic markers (Bcl-2, Bax, PARP, CAS3)

• Pathway analysis:

  • Western blotting for components of AKT/Wnt/β-catenin signaling

  • Analysis of epithelial-mesenchymal transition (EMT) markers (E-cadherin, N-cadherin, vimentin)

  • Investigation of FAM83D interactions with FBXW7/MCL1 pathway

• In vivo models:

  • Xenograft models using FAM83D-knockdown or overexpressing cells

  • Analysis of tumorigenicity, tumor growth, and metastatic potential

  • Patient-derived xenografts to maintain tumor heterogeneity

• Bioinformatic analyses:

  • TCGA data analysis for expression correlation with clinical outcomes

  • Single-cell RNA sequencing analysis using CancerSEA databases

  • Immune-related profiling through TISIDB

How does FAM83D interact with signaling pathways, particularly in cancer contexts?

FAM83D interacts with several signaling pathways:

• AKT/Wnt/β-catenin pathway:

  • FAM83D silencing decreases phosphorylation levels of AKT and glycogen synthase kinase-3β

  • This inhibits activation of the Wnt/β-catenin pathway

  • Suppression of AKT abolishes FAM83D-mediated activation of Wnt/β-catenin signaling

  • Re-expression of β-catenin reverses FAM83D-silencing-induced antitumor effects

• FBXW7/MCL1 pathway:

  • FAM83D may enhance cell proliferation and migration while suppressing apoptosis by inhibiting the FBXW7/MCL1 pathway

• Mitotic signaling:

  • FAM83D directs CK1α to the mitotic spindle

  • This interaction is critical for proper spindle positioning and timely cell division

What are common challenges in detecting endogenous FAM83D and how can they be addressed?

Common challenges and solutions:

• Low endogenous expression levels:

  • Use sensitive detection methods (e.g., enhanced chemiluminescence for Western blots)

  • Consider enriching for mitotic cells when studying FAM83D, as expression is often higher during mitosis

  • Use signal amplification techniques for immunofluorescence

• Antibody specificity issues:

  • Validate antibodies using knockdown/knockout controls

  • Test multiple antibodies targeting different epitopes

  • Be aware of potential cross-reactivity with other FAM83 family members

• Post-translational modifications:

  • FAM83D undergoes phosphorylation during mitosis, causing mobility shifts in Western blots

  • Use phosphatase treatments to confirm phosphorylation-dependent bands

  • Consider phospho-specific antibodies for studying modified forms

How should researchers interpret contradictory results in FAM83D studies across different cancer types?

When interpreting contradictory results:

• Consider tissue-specific contexts:

  • FAM83D may have different binding partners or regulatory mechanisms in different tissues

  • Expression levels vary significantly across cancer types (AUC values range from 0.732 in KIRP to 1.000 in LAML)

• Methodology differences:

  • Compare experimental approaches (transient vs. stable knockdown, different cell lines)

  • Evaluate the efficiency of FAM83D manipulation (complete knockout vs. partial knockdown)

  • Check antibody specificity and detection methods

• Cell line heterogeneity:

  • Different cancer cell lines may have distinct genetic backgrounds affecting FAM83D function

  • Consider using multiple cell lines within the same cancer type to establish consensus

• Integrated analysis approach:

  • Combine in vitro, in vivo, and clinical data

  • Use pan-cancer and single-cell analyses to identify consistent vs. context-dependent patterns

  • Validate findings using patient samples when possible

What are promising approaches for targeting FAM83D in cancer therapy?

Promising therapeutic approaches include:

• Direct targeting strategies:

  • Development of small molecule inhibitors that disrupt FAM83D-CK1α interaction

  • Peptide-based inhibitors targeting specific protein-protein interaction domains

  • Degrader approaches (PROTACs) to induce FAM83D protein degradation

• Combination therapy approaches:

  • FAM83D silencing improves sensitivity to chemotherapy drugs like temozolomide in GBM

  • Combining FAM83D inhibition with Wnt/β-catenin pathway inhibitors

  • Targeting downstream effectors in FAM83D-regulated pathways

• Biomarker applications:

  • Using FAM83D expression as a predictive biomarker for treatment response

  • Developing companion diagnostics for FAM83D-targeted therapies

  • Monitoring FAM83D expression during treatment to assess resistance mechanisms

How can single-cell analysis enhance our understanding of FAM83D function in heterogeneous tumor environments?

Single-cell analysis approaches offer several advantages:

• Resolving tumor heterogeneity:

  • Identify subpopulations with differential FAM83D expression

  • Link FAM83D expression to specific cell states or phenotypes

  • Map FAM83D expression to spatial location within tumor microenvironments

• Multi-omics integration:

  • Combine single-cell RNA-seq with proteomics for comprehensive analysis

  • Correlate FAM83D expression with genomic alterations at single-cell resolution

  • Analyze FAM83D in the context of the CancerSEA database to identify functional correlations

• Immune microenvironment analysis:

  • Investigate relationships between FAM83D expression and immune cell infiltration

  • Analyze correlation with immunotherapy response markers

  • Utilize TISIDB and similar resources to explore immune-related associations