FAM129A Antibody

What is FAM129A and why is it important in cancer research?

FAM129A (Family with sequence similarity 129, member A), also known as Niban or C1orf24, was initially identified from a rat model of hereditary renal carcinoma . It has emerged as an important molecule in cancer research because:

• It functions as an inhibitor of apoptosis and promotes migration and proliferation in human cancers

• It plays an oncogenic role in non-small cell lung carcinoma (NSCLC) by upregulating MMP2 and Cyclin D1 through the FAK signaling pathway

• High expression of FAM129A correlates with larger tumor size, advanced TNM stage, and lymph node metastasis in NSCLC

• It serves as a potential biomarker for thyroid carcinoma in preoperative diagnostic exams

• It promotes self-renewal and maintains invasive status in glioma stem cells

Understanding FAM129A's role in cancer development and progression provides valuable insights for developing targeted therapeutic strategies and prognostic tools.

Proper storage and handling of FAM129A antibodies is essential for maintaining their effectiveness:

• Store at -20°C for long-term stability

• Most commercial FAM129A antibodies are shipped on wet ice

• They are typically provided in buffered aqueous glycerol solution

• For extended storage (>1 year), aliquoting may be recommended, though some formulations are stable without aliquoting

• When stored properly, antibodies remain stable for at least one year after shipment

• Some preparations contain 0.02% sodium azide and 50% glycerol at pH 7.3

It's important to avoid repeated freeze-thaw cycles which can degrade antibody quality and affect experimental results.

What are the recommended protocols for FAM129A immunohistochemical analysis in tissue samples?

For successful immunohistochemical detection of FAM129A in tissue samples:

• Tissue preparation:

  • Fix tissues in 10% neutral buffered formalin

  • Process and embed in paraffin blocks

  • Section at 4-5 μm thickness onto charged slides

• Antigen retrieval:

  • Primary method: Use TE buffer at pH 9.0

  • Alternative method: Citrate buffer at pH 6.0

  • Heat-induced epitope retrieval (pressure cooker or microwave) is typically required

• Antibody incubation:

  • Dilute primary antibody according to validated ratio (typically 1:50-1:500 range)

  • Incubate at 4°C overnight or at room temperature for 1-2 hours

  • Follow with appropriate HRP-conjugated secondary antibody

• Detection and interpretation:

  • FAM129A typically shows cytoplasmic localization in positive cells

  • In tumors, strong to medium staining is observed, while normal tissues show weak or negative expression

  • Consider including known positive controls (e.g., thyroid carcinoma tissues)

The expression pattern is particularly valuable in diagnostic applications, as FAM129A shows strong expression in carcinoma cells compared to weak expression in normal epithelium .

How can FAM129A knockdown or overexpression models be developed for functional studies?

Creating FAM129A manipulation models is essential for studying its functional roles:

For knockdown models:

• siRNA approach:

  • Use pre-designed validated siRNAs targeting human FAM129A (e.g., siRNA ID 128925)

  • Transfection can be performed using electroporation at 150V and 900 μF

  • Typical concentration: 100 nM in appropriate electroporation buffer

  • Control groups should use scramble siRNA (e.g., siRNA ID 4390846)

• shRNA approach:

  • Validated shRNA sequences include TRCN0000122151 (shFAM129A#1) and TRCN0000140457 (shFAM129A#2)

  • Lentiviral transfection is recommended for stable expression models

  • Perform experiments in triplicate for validation

For overexpression models:

• cDNA cloning:

  • Synthesize FAM129A cDNA from RNA isolated from samples with high FAM129A expression

  • Use primer designs with appropriate restriction sites (e.g., HindIII and BamHI) for insertion into expression vectors

  • Forward primer example: 5′ CCG AAGCTT CAGTTTCCGCGCTCAGCACAGG 3′

  • Reverse primer example: 5′ CCG GGATCC CTCCTCTGAGGGCAGCTCTGGG 3′

• Lentiviral expression system:

  • Package FAM129A construct into lentiviral particles

  • Infect target cells and select with appropriate antibiotic

  • Verify overexpression by Western blot before functional assays

These models have been successfully used to demonstrate FAM129A's impact on proliferation, invasion, and self-renewal in various cancer cells .

How can FAM129A antibodies be used to investigate cancer signaling pathways?

FAM129A antibodies are valuable tools for elucidating its role in cancer signaling networks:

• FAK pathway investigation:

  • Use FAM129A antibodies in combination with phospho-specific antibodies for FAK (Tyr397, Tyr576, Tyr925)

  • In NSCLC, FAM129A overexpression enhances phosphorylation of FAK at Tyr397 and Tyr576, but not Tyr925

  • Co-immunoprecipitation can determine if FAM129A directly interacts with FAK or acts through intermediaries

• AKT/mTOR signaling:

  • Employ antibodies against p-p70S6K (T389), p-AKT (S473), and p-ERK1/2 (T202/Y204) alongside FAM129A

  • In thyroid carcinoma, FAM129A activates the AKT/mTOR/p70S6K axis to inhibit autophagy

  • Western blot analysis after FAM129A knockdown/overexpression reveals its impact on pathway activation

• Cell cycle regulation:

  • Analyze cyclins (D1, A2, B1, E1) after FAM129A manipulation

  • FAM129A specifically upregulates Cyclin D1 in NSCLC, with no significant changes in other cyclins

  • EdU incorporation assay can complement these studies to directly measure proliferation effects

These approaches have revealed that FAM129A influences multiple oncogenic pathways, contributing to tumor cell survival, proliferation, and invasion through distinct signaling mechanisms across different cancer types .

What are the challenges in correlating FAM129A expression with patient prognosis?

Correlating FAM129A expression with clinical outcomes presents several methodological challenges:

• Standardization of detection methods:

  • Different antibodies and detection protocols can yield varying results

  • Scoring systems for IHC positivity must be clearly defined (e.g., staining intensity, percentage of positive cells)

  • In NSCLC studies, patients were categorized into FAM129A-positive and FAM129A-negative groups for Kaplan-Meier analysis

• Patient cohort considerations:

  • Sample size must be sufficient for statistical power

  • In one NSCLC study, 187 patient samples were analyzed (104 FAM129A-positive, 83 FAM129A-negative)

  • Cohorts must be well-characterized with comprehensive clinical information

• Multivariate analysis requirements:

  • Consider confounding factors such as:

    • Age and gender

    • Tumor size and histological type

    • TNM staging and lymph node status

    • Treatment history

• Validation across datasets:

  • Findings should be validated in independent patient cohorts

  • Integration with other biomarkers may improve prognostic value

In NSCLC, FAM129A expression significantly correlated with larger tumor size (P=0.036), advanced TNM stage (P<0.001), and lymph node metastasis (P=0.001), with Kaplan-Meier analysis showing poorer survival in FAM129A-positive patients (P=0.001) . This illustrates the potential of FAM129A as a prognostic biomarker when these methodological challenges are properly addressed.

How can FAM129A antibodies be used to investigate its role in cellular stress responses?

FAM129A has been implicated in multiple stress response pathways, which can be investigated using targeted antibody approaches:

• Genotoxic stress response:

  • Expose cells to UV irradiation and monitor FAM129A phosphorylation

  • FAM129A is phosphorylated in an AKT-dependent manner following UV exposure

  • Co-immunoprecipitation can detect interaction with nucleophosmin (NPM), which prevents NPM binding to MDM2, promoting p53 degradation

• Integrated stress response (ISR) pathway:

  • Analyze FAM129A as a downstream target of ATF4, a key ISR regulator

  • FAM129A confers pro-survival function during ISR by attenuating p53-dependent apoptotic responses

  • Combined immunofluorescence for FAM129A and ATF4 can reveal co-localization patterns

• Autophagy regulation:

  • Use dual fluorescent mCherry-eGFP-LC3B reporters in cells with FAM129A manipulation

  • Analyze autophagy flux via confocal microscopy

  • After siRNA knockdown of FAM129A, monitor changes in LC3B puncta formation

  • Western blot analysis for LC3B conversion (LC3I to LC3II) provides quantitative measures of autophagy activity

These approaches have revealed that FAM129A functions at the intersection of multiple stress response pathways, potentially explaining its pro-survival role in cancer cells under various environmental and therapeutic stresses .

How can non-specific binding be minimized when using FAM129A antibodies?

Non-specific binding can compromise experimental results. To minimize this issue:

• Antibody selection and validation:

  • Choose antibodies with published validation data

  • Prioritize antibodies tested against protein arrays (e.g., Prestige Antibodies tested against 364 human recombinant protein fragments)

  • Consider using affinity-isolated antibodies for higher specificity

• Blocking optimization:

  • For Western blot: 5% non-fat dry milk or BSA in TBST/PBST

  • For IHC/IF: 5-10% normal serum from the same species as the secondary antibody

  • Extend blocking time (1-2 hours at room temperature or overnight at 4°C) for challenging samples

• Antibody dilution optimization:

  • Titrate antibodies to determine optimal concentration

  • For FAM129A, typical dilutions range from 1:50-1:500 for IHC and IF, and 1:500-1:3000 for Western blot

  • Higher dilutions may reduce background but require longer incubation times

• Washing protocol refinement:

  • Increase number and duration of washes

  • Use 0.1-0.3% Tween-20 in wash buffer to reduce hydrophobic interactions

  • For IHC, consider adding 0.05% Triton X-100 to improve penetration

• Negative controls:

  • Include no-primary-antibody controls

  • Use tissues or cells known to be negative for FAM129A expression

  • For knockdown validation, include samples with validated FAM129A silencing

These approaches collectively enhance signal specificity and reliability of FAM129A detection across experimental platforms.

How can I validate FAM129A antibody specificity across different experimental systems?

Thorough validation of FAM129A antibody specificity is crucial for generating reliable research data:

• Multi-technique validation:

  • Compare results across Western blot, IHC, and IF applications

  • Consistent molecular weight detection (~103-150 kDa) across blotting techniques

  • Consistent cellular localization pattern (primarily cytoplasmic) in imaging techniques

• Positive control selection:

  • Use cell lines with known FAM129A expression:

    • A431 and DU 145 cells (positive in Western blot)

    • HepG2 cells (positive in immunofluorescence)

  • Tissue samples: thyroid carcinoma and pancreatic cancer tissues show high expression

• Genetic manipulation controls:

  • siRNA/shRNA knockdown should reduce antibody signal proportionally to mRNA reduction

  • Overexpression systems should show increased signal intensity

  • CRISPR/Cas9 knockout provides the most stringent specificity control

• Cross-reactivity assessment:

  • Test in multiple species if conducting comparative studies

  • Verify epitope conservation across species for the specific antibody

  • Current commercial antibodies have been validated primarily with human samples

• Epitope blocking:

  • Pre-incubate antibody with immunizing peptide before application

  • Signal should be significantly reduced or eliminated

  • Commercial blocking peptides may be available for specific antibodies

By implementing these validation strategies, researchers can ensure that observations attributed to FAM129A are specific and reproducible across experimental systems.

How is FAM129A antibody being used to explore its role beyond cancer?

FAM129A research is expanding beyond oncology into other disease areas and physiological processes:

• Inflammation and immune response:

  • FAM129A levels are significantly increased in neutrophils exposed to septic serum

  • The difference in expression between neutrophils exposed to non-severe versus severe sepsis plasma is statistically significant (p<0.01)

  • This suggests potential roles in neutrophil function during inflammatory conditions

  • Immunophenotyping with FAM129A antibodies might reveal new insights into inflammatory cell populations

• Cellular stress response mechanisms:

  • FAM129A is a downstream target of ATF4 in the integrated stress response

  • Immunofluorescence co-staining with stress response markers (e.g., phospho-eIF2α) can map FAM129A's role in cellular adaptation to various stressors

  • Potential applications in neurodegenerative diseases where stress response is dysregulated

• Developmental biology:

  • Expression patterns across normal tissues suggest tissue-specific functions

  • Antibody-based tissue profiling across developmental stages could reveal temporal regulation patterns

  • Spatial expression mapping may identify specialized cellular niches with high FAM129A expression

These emerging research directions highlight FAM129A's potentially broader physiological significance beyond its established roles in cancer progression.

What new antibody-based techniques are being developed to study FAM129A phosphorylation states?

FAM129A function is regulated by phosphorylation, creating opportunities for advanced antibody-based studies:

• Phospho-specific antibodies:

  • Development of antibodies against key phosphorylation sites (e.g., Ser602)

  • These enable direct monitoring of FAM129A activation state

  • Useful for signaling pathway analysis and response to therapeutic interventions

• Proximity ligation assays (PLA):

  • Allows visualization of FAM129A interactions with binding partners

  • Can detect co-localization with AKT, which phosphorylates FAM129A following UV irradiation

  • Provides single-molecule resolution of protein-protein interactions in fixed cells

• Mass spectrometry integration:

  • Immunoprecipitation with FAM129A antibodies followed by mass spectrometry

  • Enables comprehensive mapping of phosphorylation sites and their dynamics

  • Quantitative analysis of phosphorylation changes under various conditions

• Phospho-proteomic arrays:

  • Antibody microarrays that capture phosphorylated FAM129A from cell lysates

  • Allow high-throughput screening of FAM129A phosphorylation across multiple conditions

  • Can reveal previously unknown regulatory mechanisms

These emerging techniques promise to reveal how FAM129A phosphorylation states correlate with its diverse functions in cellular processes, potentially identifying new therapeutic targets.

What are the current limitations in FAM129A antibody research and future opportunities?

Current research using FAM129A antibodies faces several limitations but also presents exciting opportunities:

Current limitations:

• Variability in antibody performance across applications and tissues

• Limited number of validated phospho-specific antibodies

• Incomplete understanding of FAM129A's structural domains and their functions

• Few studies examining FAM129A in normal physiology versus disease states

• Limited data on species conservation and cross-reactivity of current antibodies

Future opportunities:

• Multi-omics integration:

  • Combining antibody-based detection with transcriptomics and proteomics

  • Correlating protein expression patterns with genetic variants

  • Creating comprehensive models of FAM129A regulation networks

• Therapeutic targeting validation:

  • Using antibodies to validate FAM129A as a therapeutic target

  • Developing function-blocking antibodies

  • Monitoring therapy response through FAM129A expression changes

• Single-cell analysis:

  • Applying antibodies for single-cell protein profiling

  • Identifying FAM129A-expressing cell populations within heterogeneous tissues

  • Tracking dynamic changes in expression during disease progression

• Structural studies:

  • Using antibodies to map functional domains through epitope analysis

  • Developing conformation-specific antibodies that distinguish active vs. inactive states

  • Supporting crystallography studies through co-crystallization approaches