FASTKD2 Antibody, FITC conjugated

What are the validated applications for FASTKD2-FITC conjugated antibodies?

FASTKD2-FITC conjugated antibodies have been primarily validated for immunofluorescence (IF) and flow cytometry applications. According to current research protocols, these antibodies are particularly valuable for:

• Intracellular localization studies focusing on mitochondrial research

• Flow cytometric analysis of FASTKD2 expression in various cell populations

• Live cell imaging when studying mitochondrial dynamics

While ELISA applications have been documented for some FASTKD2-FITC antibodies , researchers should note that unconjugated forms typically show broader application ranges including Western Blot (WB) and immunohistochemistry (IHC) . The FITC conjugation offers significant advantages in fluorescence-based applications but may limit certain other detection methods.

What is the optimal dilution range for FASTKD2-FITC antibodies in immunofluorescence studies?

Based on established research protocols, the optimal dilution for FASTKD2-FITC antibodies in immunofluorescence applications typically ranges between 1:20-1:200 . This relatively wide range reflects the variability between different experimental systems and cell types. Consider the following guidelines when determining optimal dilution:

• For initial optimization with new cell types, begin with a 1:50 dilution and adjust as needed

• When working with cells known to express high levels of FASTKD2 (e.g., HeLa, HepG2), a higher dilution (1:100-1:200) may be sufficient

• For cells with lower FASTKD2 expression, more concentrated antibody preparations (1:20-1:50) may be required

The signal intensity should be assessed through proper controls, including secondary antibody-only controls to determine background fluorescence levels .

How should FASTKD2-FITC antibodies be stored to maintain optimal activity?

Proper storage is crucial for maintaining the activity of FITC-conjugated antibodies. Research-grade FASTKD2-FITC antibodies should be stored according to these guidelines:

• Store at -20°C or -80°C immediately upon receipt

• Avoid repeated freeze-thaw cycles, which can significantly reduce antibody activity and FITC fluorescence

• For working solutions, aliquot into single-use volumes before freezing

• When preparing dilutions, use buffers containing stabilizers (typically PBS with 0.05% stabilizer and 50% glycerol)

• Protect from light exposure during all handling steps to prevent photobleaching of the FITC conjugate

Most commercial FASTKD2-FITC antibodies maintain stability for approximately 12 months when stored properly .

How can I validate the specificity of FASTKD2-FITC antibodies in my experimental system?

Validating antibody specificity is critical for producing reliable research results. For FASTKD2-FITC antibodies, implement these validation approaches:

• siRNA knockdown controls: Use siRNA targeting FASTKD2 (validated sequence: ATGAATCACCGATCTCTTATA) to create knockdown cells, then compare FITC signal between knockdown and control cells

• Overexpression controls: Transfect cells with FASTKD2-FLAG tagged constructs and co-stain with anti-FLAG and FASTKD2-FITC antibodies to confirm co-localization

• Western blot correlation: If possible, perform parallel western blot analysis using unconjugated FASTKD2 antibodies to verify that the FITC signal corresponds with protein expression levels

• Subcellular localization: Confirm that the staining pattern shows expected mitochondrial localization, potentially using mitochondrial markers like MitoTracker for co-localization studies

Researchers should note that FASTKD2 typically shows a predicted molecular weight of 81 kDa, but the observed weight in experimental systems is often between 55-65 kDa .

What cell fixation and permeabilization methods work best with FASTKD2-FITC antibodies?

The choice of fixation and permeabilization methods significantly impacts FASTKD2 detection. Based on published protocols:

• Formaldehyde fixation (4%) for 10-15 minutes at room temperature provides good preservation of cellular architecture while maintaining antibody access to FASTKD2

• Permeabilization with 0.2% Triton X-100 in PBS for 10 minutes at room temperature allows optimal antibody penetration to the mitochondrial compartment

• Blocking with 3% BSA in PBS for 45 minutes helps reduce background staining

Alternative approaches include:

• Methanol fixation (-20°C for 10 minutes) for simultaneous fixation and permeabilization

• For flow cytometry applications, gentler permeabilization with 0.1% saponin may be preferred

These methods have been successfully employed in studies visualizing mitochondrial localization of FASTKD2 in various cell types including HeLa, COS7, and U2OS cells .

How can I optimize FASTKD2-FITC antibodies for live cell imaging studies?

Live cell imaging with FASTKD2-FITC antibodies presents unique challenges due to the mitochondrial localization of FASTKD2. Consider these methodological approaches:

• Cell delivery optimization:

  • Low-toxicity protein delivery reagents (such as ProDeliverIN or BioPORTER) can facilitate antibody internalization

  • Microinjection techniques may be necessary for precise control of antibody delivery

  • Anti-peptide antibodies targeting extracellular domains may provide alternatives

• Imaging parameters:

  • Use low laser power and minimal exposure times to reduce phototoxicity

  • Consider pulse-chase approaches to minimize continuous imaging

  • Employ rapid acquisition techniques to capture dynamic mitochondrial processes

• Controls and validation:

  • Include non-specific FITC-conjugated IgG controls to assess background

  • Validate observations with fixed-cell imaging using the same antibody

  • Consider parallel experiments with cells expressing FASTKD2-GFP fusion proteins

Note that the success of live cell imaging approaches will depend significantly on cell type and specific experimental goals .

How can FASTKD2-FITC antibodies be used to study mitochondrial dynamics and apoptosis?

FASTKD2-FITC antibodies offer powerful tools for investigating mitochondrial dynamics and apoptosis pathways. Implementation strategies include:

• Co-localization studies:

  • Combine FASTKD2-FITC with markers for mitochondrial fission (DRP1, MFF) and fusion (MFN1, MFN2) to investigate spatial relationships during dynamic processes

  • Correlate FASTKD2 localization with mitochondrial nucleoids using appropriate DNA stains

• Apoptotic cascade analysis:

  • Track FASTKD2 distribution during early apoptotic stages using Annexin V co-staining

  • Monitor mitochondrial morphology changes in relation to FASTKD2 expression following apoptotic stimuli

  • Combine with TUNEL assays to correlate FASTKD2 expression with DNA fragmentation

• Domain-specific investigations:

  • Use FASTKD2-FITC antibodies in conjunction with expression of specific FASTKD2 domains (FAST1, FAST2) to determine functional relationships

  • The 81 amino acid FAST2 domain (amino acids 538-619) has been identified as particularly important in mediating apoptotic effects

Recent research has demonstrated that DHEA treatment downregulates FASTKD2 expression, suppresses mitochondrial fission, and promotes mitochondrial fusion, providing a model system for studying these dynamics .

What is the significance of FASTKD2 in cancer research and how can FITC-conjugated antibodies contribute to this field?

FASTKD2 has emerged as a significant factor in cancer biology, particularly in lung adenocarcinoma. FASTKD2-FITC antibodies can advance this research through:

The significance of FASTKD2 in cancer is further supported by univariate and multivariate Cox regression analyses confirming FASTKD2 as an independent indicator for predicting lung cancer-specific survival .

How can researchers distinguish between FASTKD2 and other FASTKD family proteins using FITC-conjugated antibodies?

Distinguishing between the six members of the FASTKD protein family (FASTK and FASTKD1-5) requires careful experimental design:

• Antibody specificity verification:

  • Validate antibody specificity against recombinant proteins for each family member

  • Perform siRNA knockdown experiments targeting each family member individually and assess cross-reactivity

  • Use cells from FASTKD2 knockout models as negative controls

• Co-localization studies:

  • While all FASTKD proteins localize to mitochondria, they show distinct sub-mitochondrial distributions

  • Use high-resolution confocal or super-resolution microscopy with specific mitochondrial compartment markers

• Functional differentiation:

  • Unlike other family members, FASTKD2 specifically plays a role in assembly of the mitochondrial large ribosomal subunit

  • FASTKD2 uniquely forms a functional protein-RNA module with RCC1L, NGRN, RPUSD3, RPUSD4, TRUB2, and 16S mitochondrial ribosomal RNA

  • Only FASTKD2, not other family members, enhances apoptosis when overexpressed

Understanding these distinctions is crucial as research indicates specificity in their functions despite architectural similarities .

Why might I observe differences between the predicted and observed molecular weights of FASTKD2?

The discrepancy between the predicted molecular weight of FASTKD2 (81 kDa) and its commonly observed weight in experimental systems (55-65 kDa) can be attributed to several factors:

• Post-translational modifications:

  • FASTKD2 may undergo proteolytic processing after synthesis

  • Removal of the mitochondrial targeting sequence following mitochondrial import reduces protein size

• Alternative splicing:

  • Multiple isoforms have been reported with different molecular weights

  • Cell-type specific expression of variants may contribute to observed differences

• Technical considerations:

  • Protein extraction methods may affect apparent molecular weight

  • The highly structured nature of mitochondrial proteins can cause anomalous migration on SDS-PAGE

• Experimental verification:

  • Knockdown/knockout controls can confirm band identity

  • Mass spectrometry analysis of isolated bands can verify protein identity

Researchers should note this discrepancy when interpreting their results and include appropriate controls to confirm FASTKD2 detection .

What are common sources of background when using FASTKD2-FITC antibodies and how can they be minimized?

Background fluorescence can significantly impact the interpretation of FASTKD2-FITC staining results. Common sources and mitigation strategies include:

• Non-specific binding:

  • Implement more stringent blocking (5% BSA or normal serum)

  • Include 0.1% Tween-20 in antibody dilution buffers

  • Pre-absorb antibodies with cell lysates from FASTKD2 knockdown cells

• Autofluorescence:

  • Treat samples with sodium borohydride (0.1% for 10 minutes) to reduce aldehyde-induced autofluorescence

  • Use specialized quenching reagents for tissues with high autofluorescence

  • Implement spectral unmixing during image acquisition

• Fixation artifacts:

  • Optimize fixation duration (excessive fixation can increase background)

  • Consider alternative fixatives (methanol may produce less autofluorescence than formaldehyde)

  • Include freshly prepared formaldehyde rather than stored solutions

• FITC-specific considerations:

  • FITC is particularly sensitive to photobleaching; minimize exposure to light

  • FITC fluorescence is pH-sensitive; maintain consistent buffer pH (optimally 7.4)

  • Consider using higher wavelength fluorophores (Alexa 488) for tissues with high autofluorescence

Implementing appropriate negative controls (secondary antibody only, isotype controls, and pre-immune serum) is essential for distinguishing specific from non-specific signals .

How should researchers interpret discrepancies in results between FASTKD2 detection methods (immunofluorescence vs. Western blot)?

Discrepancies between different detection methods for FASTKD2 are not uncommon and may arise from several methodological factors:

• Epitope accessibility differences:

  • Antibodies targeting different epitopes may show varying accessibility in different techniques

  • Protein conformation in fixed cells versus denatured proteins can affect epitope recognition

  • The mitochondrial localization of FASTKD2 may present different accessibility challenges in different methods

• Expression level thresholds:

  • Western blot may detect total protein levels while immunofluorescence provides spatial information

  • Low expression levels might be detectable by more sensitive immunofluorescence but below Western blot detection limits

• Protocol-specific considerations:

  • Different buffer systems between methods may affect antibody binding

  • Fixation for immunofluorescence might modify epitopes differently than SDS treatment for Western blots

  • The FITC conjugation itself might affect antibody binding characteristics compared to unconjugated versions

• Resolution approaches:

  • Validate with multiple antibodies targeting different FASTKD2 epitopes

  • Include appropriate positive controls (overexpression systems) and negative controls (knockdown/knockout)

  • Complement with additional techniques (qRT-PCR for mRNA levels, mass spectrometry)

When discrepancies arise, researchers should consider that each method provides different information about FASTKD2 biology, and integration of multiple approaches may yield more comprehensive understanding .

How can FASTKD2-FITC antibodies be applied to study the role of FASTKD2 in mitochondrial translation?

Recent research has revealed FASTKD2's critical role in mitochondrial translation, offering new applications for FASTKD2-FITC antibodies:

• Co-localization with mitochondrial translation machinery:

  • Dual labeling with markers for mitochondrial ribosomes to study spatial organization

  • Time-course analysis of FASTKD2 localization during active translation periods

  • Visualization of FASTKD2's association with the protein-RNA module consisting of RCC1L, NGRN, RPUSD3, RPUSD4, TRUB2, and 16S mt-rRNA

• Response to translation inhibitors:

  • Track FASTKD2 redistribution following treatment with mitochondrial translation inhibitors

  • Correlate FASTKD2 localization changes with translation efficiency markers

  • Visualize dynamics during recovery from translation inhibition

• Disease-relevant applications:

  • Examine FASTKD2 distribution in cells from patients with mitochondrial translation disorders

  • Study compensatory responses in models of cytochrome c oxidase deficiency

  • Investigate therapeutic approaches targeting FASTKD2 in mitochondrial disease contexts

These applications leverage the finding that FASTKD2 plays an important role in the assembly of the mitochondrial large ribosomal subunit and controls 16S mt-rRNA abundance .

What methodological approaches can be used to study the relationship between FASTKD2 and mitochondrial dynamics in real-time?

Studying FASTKD2's involvement in mitochondrial dynamics requires specialized approaches to capture these rapid processes:

• Live cell imaging techniques:

  • Combine FASTKD2-FITC antibodies with permeable mitochondrial dyes (TMRM, JC-1) for monitoring membrane potential changes

  • Implement high-speed confocal or spinning disk microscopy to capture fusion/fission events

  • Use photoactivatable GFP-tagged mitochondrial markers to track individual organelle fate

• Domain-specific analysis:

  • Correlate dynamics of the FAST2 domain (aa 538-619) with apoptotic cascades using domain-specific antibodies

  • Monitor translocation of FASTKD2 from cytosol to mitochondria during stress responses

  • Track interactions between FASTKD2 and key fission/fusion proteins (DRP1, MFF, MFN1, MFN2)

• Pharmacological manipulations:

  • Use DHEA treatment as a model system to downregulate FASTKD2 and study subsequent changes in mitochondrial dynamics

  • Apply mitochondrial fission inhibitors (mdivi-1) or fusion promoters and monitor FASTKD2 redistribution

  • Employ uncouplers (CCCP) to induce mitochondrial stress and track FASTKD2 response

These approaches can help elucidate the finding that DHEA suppresses mitochondrial fission and promotes mitochondrial fusion by downregulating FASTKD2 expression .

What is the significance of FASTKD2 in non-cancer disease models and how can FITC-conjugated antibodies contribute to this research?

While FASTKD2's role in cancer has been well-documented, its functions in other diseases present important research opportunities:

• Mitochondrial disease applications:

  • FASTKD2 mutations have been linked to cytochrome c oxidase deficiency and Infantile Mitochondrial Encephalopathy

  • FITC-conjugated antibodies can help visualize abnormal FASTKD2 distribution in patient-derived cells

  • Track therapeutic interventions aimed at restoring mitochondrial function

• Neurodegenerative disease models:

  • Given the critical role of mitochondrial function in neuronal health, FASTKD2 may be relevant in conditions like Alzheimer's and Parkinson's

  • FITC-labeled antibodies enable analysis of FASTKD2 in complex neural tissues

  • Co-localization studies with markers of mitochondrial stress in neurodegenerative models

• Metabolic disorders:

  • FASTKD2's involvement in mitochondrial function suggests potential roles in metabolic diseases

  • Fluorescence-based quantification of FASTKD2 levels in insulin-responsive tissues

  • Investigation of FASTKD2 regulation in models of diabetes and metabolic syndrome