FGF17 Mouse

What is FGF17 and what is its primary role in neural development?

FGF17 belongs to the fibroblast growth factor family of secreted signaling molecules essential for central nervous system patterning. FGF17 specifically contributes to the regionalization of the rodent frontal cortex during embryonic development . It plays a significant role in the development of the midbrain-hindbrain boundary (MHB) and is expressed during critical periods of neural development . Unlike FGF8, which is embryonically lethal when knocked out, FGF17-deficient mice are viable and fertile, allowing for detailed study of its functions throughout development and into adulthood . FGF17 signaling helps establish proper formation of brain regions including the inferior colliculus, cerebellum, and frontal cortex structures that regulate complex behaviors .

What are the primary phenotypes observed in FGF17 knockout mice?

• Reduced vocalization in pups when separated from mothers and siblings

• Decreased interaction of adult males with novel females in social recognition tests

• Reduced duration of affiliative interactions during opposite-sex pair exploration of novel environments

Additionally, these mice show anatomical abnormalities in the inferior colliculus (IC) and minor foliation defects in the cerebellum .

How are FGF17 knockout mice generated and maintained for research?

FGF17 mutant mice are typically maintained through heterozygous breeding pairs (Fgf17+/− × Fgf17+/−) to produce littermate Fgf17+/+ (wildtype), Fgf17+/− (heterozygous), and Fgf17−/− (homozygous mutant) offspring . Some research protocols also use Fgf17−/− × Fgf17+/− breeding pairs to produce littermate Fgf17+/− and Fgf17−/− mice . Genotyping is performed via polymerase chain reaction from tail DNA using specific primers: CP3 (TTGGCTTCTCTGGGACTCTACC) and cre2 (CCATGAGTGAACGAACCTGG) to detect the mutant allele, and r1 (GACAGCAGAGAATCAATAGCTGC) and r2 (GAAGTTTCTCCAGCGATGGG) to detect the wild-type Fgf17 allele . Since Fgf17−/− mice are viable and fertile, they can be maintained as homozygous lines, though comparing to littermate controls is preferable for experimental rigor.

What specific social behavioral deficits are observed in FGF17-deficient mice and how are they measured?

FGF17-deficient mice exhibit several specific social behavioral deficits that have been quantified through various experimental paradigms:

• Pup vocalization deficits: When separated from their mother and siblings, Fgf17-deficient pups vocalize significantly less than wild-type controls . This is measured by recording ultrasonic vocalizations during a standardized separation period.

• Social recognition deficits: Adult male Fgf17-deficient mice show decreased interaction with a novel ovariectomized female in social recognition tests . This is typically quantified by measuring investigation time, approach frequency, and social engagement behaviors.

• Decreased affiliative interactions: During exploration of novel environments, opposite-sex pairs of Fgf17-deficient mice spend less time engaged in prolonged, affiliative interactions compared to wild-type mice . These are measured through systematic behavioral observation protocols that quantify duration and quality of social engagement.

These social deficits are particularly striking because they occur in the absence of abnormalities in other behavioral domains, suggesting a selective role for FGF17 in the development of neural circuits mediating social behavior .

How does FGF17 deficiency affect auditory processing and function in mice?

FGF17 deficiency leads to significant alterations in auditory midbrain structure and function:

• Anatomical changes: Manganese-enhanced MRI (MEMRI) analysis reveals reduction in the size of the inferior colliculus (IC), the auditory midbrain, in Fgf17−/− mice . This finding confirms and quantifies previous qualitative observations of IC reduction.

• Altered sound-evoked activity: MEMRI demonstrates significantly reduced active IC volume in Fgf17−/− mice during sound processing . While normal mice show tone-specific (16- and 40-kHz) activity patterns in the IC that are separated along the dorsal-ventral axis, Fgf17−/− mice exhibit largely overlapping patterns, indicating disruption of normal tonotopic mapping .

• Potential impact on behavior: The altered auditory function in Fgf17−/− mice may contribute to their behavioral phenotypes, particularly social communication deficits . The altered processing of auditory information could affect the perception of social cues, including vocalizations, potentially explaining some of the social interaction deficits observed.

These findings highlight an important role for FGF17 in both the anatomical and functional development of auditory circuits .

What molecular mechanisms are disrupted by FGF17 deficiency in the brain?

FGF17 deficiency disrupts several molecular pathways that contribute to the observed phenotypes:

• Immediate-early gene expression: Following social exploration of novel environments, Fgf17-deficient mice show reduced activation of the immediate-early gene Fos in the frontal cortex compared to wild-type controls . This suggests altered neuronal activity and potentially disrupted experience-dependent plasticity.

• Cortical patterning genes: Fgf17−/− mutants show altered expression domains of genes that mark subregions of the frontal cortex, even without obvious changes in gross forebrain morphology . This indicates subtle but significant alterations in molecular patterning that may impact circuit formation.

• Serum Response Factor (SRF) pathway: Recent research suggests FGF17 may be involved in activating SRF, a transcription factor that triggers expression of genes related to cytoskeleton and oligodendrocyte proliferation . This pathway appears important for myelination processes.

These molecular changes likely underlie the anatomical and behavioral phenotypes observed in Fgf17-deficient mice, providing insight into the mechanisms by which FGF17 regulates brain development and function.

What are the implications of FGF17 research for understanding neuropsychiatric disorders?

Research on FGF17-deficient mice has significant implications for understanding neuropsychiatric disorders:

• Autism spectrum disorders: The specific social deficits observed in Fgf17−/− mice are reminiscent of features seen in autism spectrum disorders in humans . These include reduced social interaction, altered communication (reduced vocalization), and deficits in social recognition.

• Developmental origins: The fact that disrupting FGF17 signaling during development leads to persistent behavioral abnormalities supports the neurodevelopmental hypothesis of psychiatric disorders . This suggests that altered signaling during critical periods can permanently affect brain circuits mediating social behavior.

• Brain region specificity: FGF17 deficiency affects specific brain regions implicated in neuropsychiatric disorders, including the frontal cortex and midbrain structures . These regional effects parallel the selective cognitive and behavioral domains affected in various psychiatric conditions.

• Translational potential: Understanding how FGF17 influences brain development and behavior may lead to new therapeutic approaches targeting FGF signaling pathways or downstream effectors to address neurodevelopmental disorders characterized by social deficits .

The selective nature of the deficits in Fgf17−/− mice makes them particularly valuable as a model for studying the specific neural circuits and developmental processes that may be disrupted in certain psychiatric conditions.

How is FGF17 involved in brain aging and potential rejuvenation processes?

Recent research has identified FGF17 as a potential brain rejuvenation factor:

• Cerebrospinal fluid (CSF) studies: Scientists have found that cerebrospinal fluid from young mice and humans contains factors that can improve memory in aged mice . FGF17 has been identified as one of the key proteins mediating this effect.

• Cognitive enhancement: When cerebrospinal fluid from young mice is injected into the brains of old mice, the latter show improvements in memory function . This effect has been attributed to FGF17 action.

• Conserved mechanisms: Studies show that CSF from young humans (24 years old) exerts similar effects in mice as young mouse CSF, suggesting the biochemical landscape favoring cognitive processes is evolutionarily conserved . This conservation increases the translational potential of these findings.

• Cellular mechanisms: FGF17 appears to stimulate Serum Response Factor (SRF), a transcription factor that triggers the expression of genes related to the cytoskeleton and oligodendrocyte proliferation . These cells form the myelin sheath protecting nerve tissues, suggesting FGF17 may enhance neural connectivity and transmission through improved myelination.

These findings suggest FGF17 may be a therapeutic target for age-related cognitive decline and potentially neurodegenerative disorders, opening a new avenue of research beyond its developmental roles.

What imaging techniques are most effective for studying FGF17 function in vivo?

Manganese-enhanced magnetic resonance imaging (MEMRI) has proven particularly valuable for studying FGF17 function in vivo:

• Anatomical analysis: MEMRI provides more complete and quantitative characterization of the Fgf17−/− mouse morphological phenotype than previous qualitative histology-based studies . This technique has detected changes in the inferior colliculus, cerebellum, olfactory bulb, hypothalamus, and frontal cortex of Fgf17−/− mice.

• Functional activity mapping: MEMRI can detect sound-evoked activity patterns in the mouse inferior colliculus based on activity-dependent accumulation of paramagnetic Mn ions in neural cells via uptake through voltage-gated calcium channels . This allows visualization of functional differences between wild-type and Fgf17−/− mice.

• Implementation protocol: For MEMRI studies, mice are typically injected intraperitoneally with an aqueous solution of MnCl₂ (0.4 mmol/kg) one day before imaging . After injection, mice are placed in a controlled acoustic environment inside an acoustic isolation chamber for 24 hours under normal living conditions.

• Data analysis: Whole brain templates are created using rigid, 12-parameter affine transformation for registration and averaging groups of mice separately . The registered brain images are then normalized, adjusting whole brain histograms to obtain equal mean and standard deviation for intensity-based analyses.

These imaging approaches provide unique insights into both the structural and functional consequences of FGF17 deficiency that would be difficult to obtain through other methods.

What behavioral assays are most sensitive for detecting FGF17-related phenotypes?

Several behavioral assays have proven particularly effective for detecting the specific phenotypes associated with FGF17 deficiency:

• Pup vocalization test: This assay measures ultrasonic vocalizations when pups are separated from their mother and siblings . It effectively captures the communication deficits in Fgf17-deficient mice.

• Social recognition test: This paradigm assesses the interaction of adult males with a novel ovariectomized female . It reveals deficits in social recognition and interaction that characterize Fgf17-deficient mice.

• Dyadic social interaction: This test examines prolonged, affiliative interactions between opposite-sex pairs during exploration of a novel environment . It captures the reduced social engagement characteristic of Fgf17-deficient mice.

• Immediate early gene mapping: While not strictly a behavioral assay, measuring Fos activation in the frontal cortex after social exploration provides a molecular readout of neural activity differences between Fgf17-deficient mice and controls .

• Sound-evoked activity mapping: Using MEMRI to visualize neural activity patterns in the inferior colliculus in response to specific tones (e.g., 16- and 40-kHz) reveals auditory processing differences that may contribute to behavioral phenotypes .

Notably, standard tests of anxiety, motor function, prepulse inhibition, and aggression show no differences between Fgf17-deficient and wild-type mice , highlighting the selective nature of the deficits and the importance of choosing appropriate behavioral assays.

What are the key future directions for FGF17 research in neuroscience?

Future research on FGF17 should focus on several promising directions:

• Circuit-level analysis: Determining the specific neural circuits affected by FGF17 deficiency and how these relate to behavioral phenotypes would provide mechanistic insights into how developmental signaling molecules shape functional brain networks.

• Therapeutic applications: Exploring whether enhancing FGF17 signaling can ameliorate social deficits or cognitive decline could lead to novel therapeutic approaches for neurodevelopmental disorders and age-related cognitive impairment.

• Human studies: Investigating whether variations in FGF17 or its signaling pathway are associated with neurodevelopmental disorders in humans could validate the translational relevance of mouse model findings.

• Interactions with other factors: Understanding how FGF17 interacts with other growth factors, neurotransmitters, and signaling pathways would provide a more comprehensive picture of the developmental processes shaping social brain circuits.

• Temporal specificity: Determining critical periods during which FGF17 signaling is most important for brain development and function could inform timing of potential therapeutic interventions.