CFL1 Antibody

What is CFL1 and why is it an important target for antibody-based detection?

Cofilin-1 (CFL1) is a crucial actin-binding protein with 166 amino acid residues and a molecular mass of 18.5 kDa in humans. It belongs to the Actin-binding proteins ADF (Actin Depolymerizing Factor) family and exhibits pH-sensitive F-actin depolymerizing activity. CFL1 is widely expressed across various tissues and plays a significant role in cytoskeletal dynamics through its ability to bind to F-actin . The protein is involved in the translocation of actin-cofilin complexes from the cytoplasm to the nucleus, making it critical for cellular movement, division, and signaling pathways . Given its involvement in multiple cellular processes and disease states, particularly in various cancers, detecting CFL1 through antibody-based methods provides valuable insights into disease mechanisms and potential therapeutic targets.

What are the common applications for CFL1 antibodies in research settings?

CFL1 antibodies are utilized across multiple experimental applications in research settings. The most common applications include:

• Western Blot (WB): Typically used with dilutions of 1:1,000 to 1:2,000 to detect CFL1 protein expression levels in cell or tissue lysates .

• Enzyme-Linked Immunosorbent Assay (ELISA): For quantitative measurement of CFL1 in various samples .

• Immunofluorescence (IF) and Immunocytochemistry (ICC): To visualize the subcellular localization of CFL1 within cells, often with dilutions around 1:100 .

• Immunohistochemistry (IHC): For detecting CFL1 in tissue sections, including both frozen (IHC-fr) and paraffin-embedded (IHC-p) preparations .

• Flow Cytometry (FC/FACS): For analyzing CFL1 expression in individual cells within a heterogeneous population .

These methods allow researchers to investigate CFL1's expression patterns, localization, and potential roles in normal physiology and disease states.

How should researchers select the appropriate CFL1 antibody for their specific experimental needs?

Selecting the appropriate CFL1 antibody requires consideration of several key factors:

• Target species reactivity: Ensure the antibody recognizes CFL1 in your species of interest. Common reactivity profiles include human (Hu), mouse (Ms), and rat (Rt), with some antibodies offering cross-reactivity across multiple species .

• Application compatibility: Verify the antibody has been validated for your intended application (WB, ELISA, IHC, etc.). Some antibodies perform well in multiple applications while others are optimized for specific techniques .

• Clonality considerations:

  • Monoclonal antibodies offer high specificity and reproducibility for a single epitope

  • Polyclonal antibodies recognize multiple epitopes, potentially providing stronger signals

• Conjugation requirements: Determine if your experimental design requires unconjugated antibodies or those conjugated with specific tags (e.g., Biotin, Cy3, Dylight488) .

• Validation evidence: Examine available validation data including Western blot images, immunofluorescence results, and citation records. Antibodies with substantial citations (e.g., 18 citations for certain CFL1 antibodies) may indicate reliability in research settings .

Always perform preliminary validation experiments with positive and negative controls to confirm the antibody's performance in your specific experimental conditions.

What are the established protocols for using CFL1 antibodies in Western blot analysis?

For optimal Western blot analysis of CFL1 using specific antibodies, researchers should follow these methodological steps:

• Sample preparation:

  • Lyse cells or tissues in RIPA buffer containing protease inhibitors

  • Quantify protein concentration (typically 20μg total protein is sufficient, as demonstrated with HeLa cell lysates)

• Gel electrophoresis and transfer:

  • Resolve proteins using SDS-PAGE (10-12% gels are typically sufficient for the 18.5 kDa CFL1 protein)

  • Transfer proteins to a nitrocellulose or PVDF membrane using standard protocols

• Antibody incubation:

  • Block membrane with appropriate blocking buffer (typically 5% non-fat milk or BSA in TBST)

  • Incubate with primary anti-CFL1 antibody at recommended dilutions (1:1,000 to 1:2,000)

  • Wash thoroughly with TBST buffer

  • Incubate with HRP-conjugated secondary antibody (typically at 1:5,000 dilution)

• Detection and analysis:

  • Visualize using ECL detection system

  • Expected band size is approximately 18-19 kDa, corresponding to the CFL1 protein

For quantitative analysis, normalize CFL1 expression to appropriate housekeeping proteins such as GAPDH or β-actin to account for loading variations across samples.

How can researchers effectively use CFL1 antibodies to investigate its role in cancer progression?

Investigating CFL1's role in cancer progression using antibody-based approaches requires sophisticated experimental designs:

• Comparative expression analysis:

  • Implement IHC or IF staining of paired tumor and adjacent normal tissues to assess differential expression patterns

  • Studies have demonstrated upregulation of CFL1 in vulvar squamous cell carcinoma relative to normal tissue, correlating with increased tumor aggressiveness

  • Conversely, expression patterns may differ by cancer type, as CFL1 shows decreased expression in chronic myeloid leukemia (CML) compared to healthy controls

• Metastasis and invasion studies:

  • Develop migration and invasion assays with CFL1 antibody-based detection after gene silencing or overexpression

  • CFL1 has been implicated in invasion and metastasis of lung, pancreatic, and gastric cancers

  • Transwell migration assays following CFL1 knockdown demonstrate decreased chemotaxis and migration capabilities of cancer cells

• Therapeutic response monitoring:

  • Track changes in CFL1 expression during treatment response using sequential sampling

  • CFL1 expression significantly increases after imatinib therapy in CML patients, suggesting potential value as a treatment response biomarker

  • Patients with lower initial CFL1 expression achieved higher Major molecular response (MMR) rates after 6 months of imatinib therapy

• Pathway interaction analysis:

  • Use co-immunoprecipitation with CFL1 antibodies to identify interaction partners

  • Investigate relationships between CFL1 and WDR1 (actin-interacting protein 1), which regulates cofilin activity and promotes cytoskeletal remodeling

These methodological approaches enable comprehensive investigation of CFL1's mechanistic contributions to cancer progression and potential therapeutic targeting.

What are the methodological considerations for studying CFL1 phosphorylation states using phospho-specific antibodies?

Studying CFL1 phosphorylation requires careful methodological considerations:

• Phosphorylation site specificity:

  • Select phospho-specific antibodies targeting the correct phosphorylation sites (particularly Ser3, the major regulatory site)

  • Verify antibody specificity using phosphatase treatments as negative controls

• Sample preservation techniques:

  • Implement rapid sample collection and processing to preserve phosphorylation states

  • Include phosphatase inhibitors (e.g., sodium orthovanadate, sodium fluoride) in lysis buffers

  • Consider using phospho-protein enrichment techniques for low-abundance samples

• Complementary detection methods:

  • Combine Western blotting with phospho-specific antibodies and total CFL1 antibodies

  • Calculate phospho-CFL1/total CFL1 ratios for accurate assessment of phosphorylation status

  • Consider Phos-tag™ SDS-PAGE for enhanced separation of phosphorylated and non-phosphorylated forms

• Functional correlation:

  • Correlate phosphorylation status with F-actin binding activity, as CFL1 phosphorylation regulates its actin-binding and depolymerizing capabilities

  • Design experiments to assess downstream effects on cytoskeletal dynamics and cellular processes

• Treatment conditions:

  • Include appropriate controls and treatment conditions that modulate CFL1 phosphorylation

  • Consider time-course experiments to capture dynamic phosphorylation changes

These methodological approaches enable precise characterization of CFL1 phosphorylation status and its functional implications in normal and pathological states.

How can researchers effectively use CFL1 antibodies in studying leukemia pathophysiology?

CFL1 antibodies can be strategically employed in leukemia research through these methodological approaches:

• Expression profiling across leukemia subtypes:

  • Implement flow cytometry with CFL1 antibodies to quantify expression in different leukemic cell populations

  • Studies have shown distinct CFL1 expression patterns between chronic lymphocytic leukemia (CLL) and chronic myeloid leukemia (CML), with higher expression in CLL compared to healthy controls but lower expression in CML

• Functional assays following genetic manipulation:

  • Perform CFL1 gene silencing through siRNA or CRISPR-Cas9 approaches

  • Assess effects on cell viability, apoptosis, cell cycle progression, and motility

  • CFL1 knockdown studies in CLL demonstrated increased apoptosis with higher proportion of cells in G2/M phase, suggesting its role in maintaining leukemic cell viability

• Treatment response monitoring:

  • Track CFL1 expression changes during therapeutic interventions

  • CML patients show significant upregulation of CFL1 after imatinib therapy, potentially serving as a response biomarker

  • Lower baseline CFL1 expression correlates with higher rates of Major molecular response (MMR) after 6 months of imatinib therapy

• RNA-protein correlation studies:

  • Combine RT-qPCR for CFL1 mRNA quantification with protein detection via antibody-based methods

  • RT-PCR primers (forward: GCGTAAGTCTTCAACGCCAGAG, reverse: TCGACAGTCTGGCCCACATC) can be used for mRNA detection in conjunction with protein analysis

• Migration and chemotaxis assays:

  • Utilize Transwell methods following CFL1 knockdown to assess effects on leukemic cell migration

  • CLL cells with silenced CFL1 show decreased chemotaxis and migration compared to healthy volunteer cells

These approaches provide comprehensive insights into CFL1's role in leukemia pathophysiology and potential therapeutic implications.

What are the technical challenges and potential troubleshooting strategies when using CFL1 antibodies in multi-parameter flow cytometry?

Multi-parameter flow cytometry with CFL1 antibodies presents several technical challenges requiring specific troubleshooting approaches:

• Intracellular staining optimization:

  • Challenge: CFL1 is primarily an intracellular protein requiring permeabilization

  • Solution: Optimize fixation and permeabilization protocols; test different reagents (e.g., saponin, methanol, commercial kits) to determine optimal conditions for CFL1 epitope preservation while maintaining surface marker integrity

• Panel design considerations:

  • Challenge: Spectral overlap between fluorophores in complex panels

  • Solution: Perform fluorescence minus one (FMO) controls; consider using CFL1 antibodies conjugated to bright fluorophores (e.g., PE, APC) for optimal separation from other markers; perform proper compensation with single-stained controls

• Antibody titration:

  • Challenge: Non-specific binding or insufficient signal

  • Solution: Perform detailed titration experiments for CFL1 antibodies to determine optimal concentration; start with manufacturer's recommendations (often 1:100) but test a range of dilutions

• Signal normalization:

  • Challenge: Distinguishing true differences in CFL1 expression from technical variation

  • Solution: Include appropriate isotype controls; normalize to reference cell populations or beads; consider using quantitative flow cytometry with calibration beads

• Protocol validation:

  • Challenge: Ensuring reproducibility and reliability of CFL1 detection

  • Solution: Validate protocol using cell lines with known CFL1 expression levels; include positive controls (e.g., HeLa cells) that express detectable CFL1 levels

• Co-expression analysis:

  • Challenge: Correlating CFL1 expression with other markers in leukemia subtypes

  • Solution: Design panels that include established leukemia markers alongside CFL1; use hierarchical gating strategies to identify specific cell populations before analyzing CFL1 expression

These technical approaches improve the reliability and interpretability of CFL1 detection in multi-parameter flow cytometry experiments.

How can CFL1 antibodies be utilized in biomarker research for cancer prognosis and treatment response?

CFL1 antibodies offer significant utility in cancer biomarker research through these methodological approaches:

• Prognostic biomarker development:

  • Implement tissue microarray analysis with CFL1 antibodies across large patient cohorts

  • Correlate expression patterns with clinical outcomes and survival data

  • Studies have linked CFL1 overexpression with tumor aggressiveness in vulvar squamous cell carcinoma

  • The combination of anti-WDR1 and anti-CFL1 antibody patterns in patient serum has been identified as a poor prognostic factor in esophageal carcinoma

• Treatment response monitoring:

  • Develop standardized IHC or ELISA protocols to quantify CFL1 before and during treatment

  • CML patients show significant changes in CFL1 expression following imatinib therapy

  • Lower baseline CFL1 expression correlates with higher major molecular response rates, potentially guiding treatment decisions

• Liquid biopsy development:

  • Establish protocols for detecting circulating CFL1 or anti-CFL1 autoantibodies in patient serum

  • The SEREX method has successfully identified autoantibodies against CFL1 in patient sera

  • Standardize quantification through ELISA or other immunoassays for clinical application

• Multimarker panel integration:

  • Combine CFL1 with other established biomarkers for improved prognostic value

  • Investigate synergistic relationships between CFL1 and related proteins like WDR1, which regulates cofilin activity

These approaches facilitate the translation of CFL1 research into clinically relevant biomarkers for cancer management and personalized treatment strategies.

What methodological considerations should researchers address when developing immunohistochemistry protocols for CFL1 detection in clinical tissue samples?

Developing robust immunohistochemistry protocols for CFL1 detection in clinical samples requires addressing several critical methodological considerations:

• Pre-analytical variables:

  • Standardize tissue collection, fixation time (typically 24-48 hours in 10% neutral buffered formalin), and processing

  • Optimize antigen retrieval methods (heat-induced epitope retrieval using citrate or EDTA buffers) to expose CFL1 epitopes masked during fixation

  • Evaluate the impact of tissue age and storage conditions on CFL1 immunoreactivity

• Antibody selection and validation:

  • Evaluate multiple anti-CFL1 antibodies that are validated for IHC applications

  • Perform antibody validation using positive control tissues with known CFL1 expression

  • Include negative controls (primary antibody omission, isotype controls) to assess non-specific binding

• Detection system optimization:

  • Compare DAB-based chromogenic detection versus immunofluorescence for specific research questions

  • For dual staining with other markers, carefully select compatible detection systems

  • Establish optimal antibody concentration through titration experiments (starting with manufacturer recommendations)

• Scoring and quantification methods:

  • Develop standardized scoring systems (e.g., H-score, Allred score) for CFL1 staining intensity and distribution

  • Consider digital pathology and image analysis software for objective quantification

  • Establish inter-observer and intra-observer reproducibility through multiple independent scoring

• Clinical correlation challenges:

  • Design studies with sufficient statistical power to correlate CFL1 expression with clinical outcomes

  • Address potential confounding variables through multivariate analysis

  • Establish thresholds for "positive" versus "negative" or "high" versus "low" expression that correlate with biological or clinical significance

These methodological considerations enhance the reliability and clinical utility of CFL1 immunohistochemistry in translational research applications.

What quality control measures should researchers implement when working with CFL1 antibodies?

Implementing rigorous quality control measures for CFL1 antibodies ensures experimental reliability:

• Initial validation procedures:

  • Perform Western blot analysis to confirm detection at the expected molecular weight (18.5 kDa)

  • Include both positive controls (e.g., HeLa cell lysates) and negative controls (e.g., CFL1 knockdown samples)

  • Verify specificity through peptide competition assays or knockout/knockdown validation

• Lot-to-lot consistency testing:

  • Compare new antibody lots against previously validated lots

  • Maintain reference samples for consistent comparison

  • Document key performance metrics including signal intensity, background levels, and specificity

• Cross-reactivity assessment:

  • Test for potential cross-reactivity with related proteins (e.g., cofilin-2, ADF)

  • Verify species cross-reactivity claims when working with non-human models

  • Consider specificity for post-translationally modified forms of CFL1

• Application-specific controls:

  • For IHC/IF: Include tissue sections or cells with known CFL1 expression patterns

  • For Western blot: Use recombinant CFL1 as size reference

  • For ELISA: Generate standard curves with purified protein

• Antibody storage and handling:

  • Aliquot antibodies to avoid repeated freeze-thaw cycles

  • Maintain proper storage conditions according to manufacturer recommendations

  • Track antibody age and performance over time

• Documentation practices:

  • Maintain detailed records of antibody catalog numbers, lot numbers, and validation results

  • Document experimental conditions that affect antibody performance

  • Consider publishing validation data as supplementary material in research publications

These quality control measures minimize experimental variability and strengthen the reliability of research findings using CFL1 antibodies.

How can researchers address non-specific binding and background issues when using CFL1 antibodies in immunofluorescence studies?

Addressing non-specific binding and background issues in CFL1 immunofluorescence requires systematic optimization:

• Blocking optimization:

  • Test different blocking agents (BSA, normal serum, commercial blockers) to identify optimal formulation

  • Extend blocking time (1-2 hours at room temperature or overnight at 4°C) for challenging samples

  • Consider adding 0.1-0.3% Triton X-100 to blocking buffer for better penetration

• Antibody dilution optimization:

  • Perform systematic titration experiments starting with manufacturer's recommendations (typically 1:100 for immunofluorescence)

  • Balance signal intensity with background reduction

  • Consider longer incubation times with more dilute antibody solutions

• Washing protocol refinement:

  • Increase wash frequency and duration between antibody incubations

  • Use gentle agitation during washes to enhance removal of unbound antibodies

  • Include detergent (0.05-0.1% Tween-20) in wash buffers to reduce non-specific interactions

• Autofluorescence reduction:

  • Implement autofluorescence quenching methods (e.g., Sudan Black B, CuSO4 treatment)

  • Select fluorophores that avoid spectral overlap with tissue autofluorescence

  • Use confocal microscopy with narrow bandpass filters to improve signal discrimination

• Secondary antibody considerations:

  • Use highly cross-adsorbed secondary antibodies to minimize cross-reactivity

  • Include secondary-only controls to assess non-specific binding

  • Consider using directly conjugated primary antibodies to eliminate secondary antibody issues

• Sample-specific optimizations:

  • Adjust fixation protocols to preserve CFL1 epitopes while maintaining cellular morphology

  • Optimize permeabilization conditions based on subcellular localization of CFL1

  • Consider antigen retrieval methods for heavily fixed or archived samples

These methodological refinements significantly improve signal-to-noise ratio in CFL1 immunofluorescence studies, as demonstrated in validated protocols showing clear cytoplasmic and nuclear CFL1 localization in HeLa cells .

What emerging research directions involve CFL1 antibodies in understanding disease mechanisms?

CFL1 antibody applications are expanding into several promising research directions:

• Role in therapeutic resistance mechanisms:

  • Investigating CFL1's involvement in treatment resistance through cytoskeletal remodeling

  • Studies showing CFL1 upregulation after imatinib therapy suggest potential compensatory mechanisms worth exploring

  • Developing combination therapies targeting CFL1 and primary oncogenic pathways

• Autoantibody signatures in cancer diagnostics:

  • Expanding research on anti-CFL1 autoantibodies as diagnostic and prognostic markers

  • The combination of anti-WDR1 and anti-CFL1 antibody patterns shows promise for esophageal carcinoma prognosis

  • Developing multi-marker panels that include CFL1 for early cancer detection

• Single-cell analysis of CFL1 in heterogeneous populations:

  • Implementing CFL1 antibodies in single-cell proteomics and mass cytometry

  • Investigating cellular heterogeneity in CFL1 expression within tumors

  • Correlating CFL1 expression with cellular states and differentiation stages

• CFL1 in immune cell function and immunotherapy response:

  • Exploring CFL1's role in immune cell migration and function

  • Investigating connections between CFL1 and immunotherapy efficacy

  • Developing combination approaches targeting CFL1 to enhance immunotherapy responses

• Spatial proteomics applications:

  • Implementing CFL1 antibodies in multiplex imaging technologies

  • Mapping CFL1 expression and activation in tissue microenvironments

  • Correlating spatial CFL1 patterns with disease progression