FTSJ2 Human

FtsJ RNA Methyltransferase Homolog 2 Human Recombinant
Shipped with Ice Packs
In Stock

Description

FTSJ2 Human Recombinant produced in E. coli is a single polypeptide chain containing 219 amino acids (51-246) and having a molecular mass of 24.1 kDa.
FTSJ2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Product Specs

Introduction
FTSJ2 (FtsJ RNA Methyltransferase Homolog 2) is a member of the S-adenosylmethionine-binding protein family. This nucleolar protein plays a role in cell cycle regulation, DNA repair, and the processing and modification of rRNA. FTSJ2 is widely expressed, with the highest levels found in muscle, placenta, and heart tissues.
Description
Recombinant human FTSJ2, expressed in E. coli, is a single polypeptide chain consisting of 219 amino acids (residues 51-246). It has a molecular weight of 24.1 kDa. The protein includes a 23 amino acid His-tag fused at the N-terminus and is purified using proprietary chromatographic techniques.
Physical Appearance
Clear, colorless solution, sterile-filtered.
Formulation
The FTSJ2 solution is provided at a concentration of 1mg/ml in a buffer consisting of 20mM Tris-HCl (pH 8.0), 0.15M NaCl, 1mM DTT, and 30% glycerol.
Stability
For short-term storage (2-4 weeks), the product can be stored at 4°C. For extended storage, it is recommended to freeze the product at -20°C. Adding a carrier protein (0.1% HSA or BSA) is advised for long-term storage. Avoid repeated freeze-thaw cycles.
Purity
The purity of the FTSJ2 protein is greater than 95% as determined by SDS-PAGE analysis.
Synonyms
FtsJ RNA methyltransferase homolog 2 (E. coli), putative ribosomal RNA methyltransferase 2, MRM2 RNA methyltransferase homolog, rRNA (uridine-2'-O-)-methyltransferase, cell division protein FtsJ, Protein ftsJ homolog 2, MRM2, FJH1, EC 2.1.1.-.
Source
E.coli.
Amino Acid Sequence
MGSSHHHHHH SSGLVPRGSH MGSSYRCRSA FKLLEVNERH QILRPGLRVL DCGAAPGAWS QVAVQKVNAA GTDPSSPVGF VLGVDLLHIF PLEGATFLCP ADVTDPRTSQ RILEVLPGRR ADVILSDMAP NATGFRDLDH DRLISLCLTL LSVTPDILQP GGTFLCKTWA GSQSRRLQRR LTEEFQNVRI IKPEASRKES SEVYFLATQY HGRKGTVKQ

Q&A

What is FTSJ2 and what is its primary function in human cells?

FTSJ2 is a novel human gene encoding a putative RNA methyltransferase that belongs to a family of evolutionarily conserved S-adenosylmethionine-binding proteins. It shares significant sequence homology with FtsJ/RrmJ, an Escherichia coli 23S rRNA uridine-2'-O-methyltransferase . The primary function of FTSJ2 appears to be involvement in RNA processing and modification, specifically performing 2'-O-ribose methylation of ribosomal RNA. Current research suggests it plays a role in mitochondrial RNA modification, which is crucial for proper RNA folding, stability, and function .

Methodological approach: To study FTSJ2's methyltransferase activity, researchers should consider:

  • In vitro methylation assays using recombinant FTSJ2 protein

  • Analyzing methylation patterns in target RNAs using primer extension assays

  • Creating point mutations in the SAM-binding domain to validate catalytic function

Where is FTSJ2 localized in human cells?

There are conflicting reports regarding the subcellular localization of FTSJ2. Early studies suggested that FTSJ2 protein localizes to the nucleolus , while more recent research has demonstrated that FTSJ2 is primarily a mitochondrial protein . Immunofluorescence studies in rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines showed that most of the FTSJ2 protein was located in the cytoplasm but not in the nuclei, and co-localized with mitochondria when stained with MitoTracker Red. Further analysis of mitochondrial and cytosolic protein fractions confirmed that FTSJ2 was detected in the mitochondrial protein fraction but not in the cytosolic fraction .

Methodological approach: To determine subcellular localization:

  • Perform immunofluorescence with organelle-specific markers (MitoTracker Red for mitochondria)

  • Conduct subcellular fractionation to isolate mitochondrial and cytosolic components

  • Verify with Western blot analysis using anti-FTSJ2 antibodies on isolated fractions

  • Consider using fluorescent protein fusions for live-cell imaging

What is the genomic location and structure of the FTSJ2 gene?

The FTSJ2 gene is located on chromosome 7p22 between MAD1L1 and NUDT1. The gene spans approximately 8 kb in length and consists of three exons . This genomic region has been of interest in cancer studies, particularly in non-small cell lung cancer (NSCLC), where FTSJ2 locus has been identified in a potentially oncogenic region .

Methodological approach: For genomic analysis:

  • Use PCR-based methods to amplify specific regions of the gene

  • Apply next-generation sequencing for comprehensive analysis

  • Perform Southern blot analysis for structural variations

  • Consider chromatin immunoprecipitation (ChIP) to study transcription factor binding

In which human tissues is FTSJ2 primarily expressed?

Northern blot analysis has revealed that FTSJ2 transcripts are abundant in skeletal muscle, placenta, and heart, as well as in cancer cells . This tissue-specific expression pattern suggests potential specialized functions in these tissues. The elevated expression in cancer cells has prompted investigation into its potential role in oncogenesis .

Methodological approach: For expression analysis:

  • Perform Northern blot analysis with tissue-specific RNA

  • Use RT-qPCR for quantitative tissue expression profiling

  • Consider RNA-seq for comprehensive transcriptome analysis

  • Validate with protein-level analysis using Western blot or immunohistochemistry

How does heat shock stress affect FTSJ2 expression in different tissues?

Heat shock stress induces differential FTSJ2 expression across tissues, reflecting its conserved heat shock protein characteristics. In porcine models exposed to increased temperatures (30°C or 35°C), FTSJ2 mRNA expression was upregulated in the large intestine, stomach, lung, and bladder, while it was downregulated in the small intestine, muscle, heart, mammary gland, kidney, spleen, and liver .

Notably, the lung was the only tissue that showed upregulation of both FTSJ2 and HSP70.2 (a classic heat shock protein), possibly due to direct exposure to increased temperature through inhalation of hot air .

In vitro studies with human lung adenocarcinoma cells (A549) confirmed this response. When subjected to heat shock at 42°C or 45°C for 1 hour followed by recovery at 37°C, FTSJ2 mRNA expression increased by more than 50% compared to non-heat shocked controls .

Methodological approach:

  • In vivo: Expose animal models to controlled temperature increases (30-35°C)

  • In vitro: Subject cell cultures to 42-45°C for 1 hour followed by recovery periods

  • Analysis: Quantify mRNA expression using real-time RT-PCR

  • Always include HSP70.2 as a positive control for heat shock response

What is the role of FTSJ2 in cancer cell migration and invasion?

Contrary to initial expectations based on its amplification in some lung cancer samples, FTSJ2 appears to inhibit cancer cell migration and invasion. The expression of FTSJ2 mRNA was decreased in the more invasive subline (CL1-5) of lung adenocarcinoma cells compared with the less invasive subline (CL1-0). Furthermore, overexpression of FTSJ2 resulted in the inhibition of cell invasion and migration in rhabdomyosarcoma cells (TE671) .

Methodological approach for invasion studies:

  • Wound healing assay:

    • Grow cells to 90% confluence in 60-mm dishes

    • Create a wound by scraping the cell monolayer with a sterile P200 pipette tip

    • Capture time-lapse images every 10 minutes for 12 hours

    • Calculate cell migration area as [healing area/wounding area]×100% using ImageJ software

  • Invasion assay:

    • Use Trans-well chambers with 8-μm pore size

    • Pre-coat the upper chamber with Geltrex matrix gel (30 μL/well)

    • Add cells (1×10^4) suspended in 200 μL of DMEM to the upper chamber

    • After 12 hours, remove cells on the upper surface with a cotton swab

    • Fix cells on the lower surface with methanol for 10 minutes

    • Perform Giemsa staining and calculate the Giemsa-positive area

What are the recommended primers for FTSJ2 detection in experimental models?

For reliable detection of FTSJ2 expression in human and animal models, the following validated primers have been used successfully:

SpeciesGeneSense (5′-3′)Anti-sense (5′-3′)
HumanFTSJ2GCTGGTGTGTGTTTCCTTTCACAGAATCTGGTGCCTCTCGT
HSP70.2GCACGTTCGACGTGTCCATGCTTGTTCTGGCTGATGTCCTT
β-actinCCGTCTTCCCCTCCATCGTGGGCGCAGCTCATTGTAGAAGGTGTGG
GAPDHGAGAAACCTGCCAAGTATGATGACCTGGTCCTCAGTGTAGCC
PigFtsj2ACGAGTTCCCAGGAGAATCAGATGCTTTGGCAACGACCTTTAA
Hsp70.2GCACGTTCGACGTGTCCATGCTTGTTCTGGCTGATGTCCTT
β-actinCATCACCATCGGCAACGATTCCTGATGTCCACGTCGC

These primers are suitable for both real-time quantitative PCR and semi-quantitative RT-PCR applications .

Methodological approach for PCR-based detection:

  • Optimize annealing temperature (recommended: 58-60°C)

  • Include appropriate reference genes (β-actin, GAPDH) for normalization

  • For heat shock studies, use HSP70.2 as a positive control

  • Always perform melt curve analysis to verify amplification specificity

  • Consider designing intron-spanning primers to avoid genomic DNA amplification

How can researchers overexpress FTSJ2 in cell models?

For effective overexpression of FTSJ2 in experimental models, a vector for the overexpression of human FTSJ2 driven by the CMV promoter has been successfully used (pCMV-hFTSJ2-IRES2-DsRed2) .

Methodological approach:

  • Construct design:

    • Use a strong promoter (e.g., CMV) to drive FTSJ2 expression

    • Include a reporter gene (e.g., DsRed2) for visualization of transfection efficiency

    • Consider adding an IRES sequence for bicistronic expression

  • Transfection protocol:

    • For rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines, lipid-based transfection methods have been effective

    • Optimize cell density (recommended: 70-80% confluence at transfection)

    • Include appropriate controls (empty vector, irrelevant protein)

  • Validation:

    • Confirm overexpression by Western blot analysis using anti-FTSJ2 antibodies

    • Verify subcellular localization by immunofluorescence

    • Assess functional consequences using appropriate assays (e.g., migration, invasion)

What is the relationship between FTSJ2 and mitochondrial RNA modification?

FTSJ2 is a mammalian ortholog of yeast Mrm2p, which is responsible for the 2′-O-ribose methylation of the mitochondrial 21S rRNA in Saccharomyces cerevisiae . The mitochondrial localization of human FTSJ2 suggests it performs a similar function in human cells, likely methylating mitochondrial ribosomal RNA.

Methodological approach to study RNA modification:

  • Primer extension analysis:

    • Design primers that anneal downstream of potential modification sites

    • Perform reverse transcription under conditions where enzyme pauses at modified nucleotides

    • Analyze extension products by high-resolution gel electrophoresis

  • Mass spectrometry:

    • Isolate mitochondrial RNA from cells with and without FTSJ2

    • Digest RNA into nucleosides

    • Analyze by LC-MS/MS to identify and quantify modified nucleosides

  • CLIP-seq (Crosslinking and Immunoprecipitation followed by sequencing):

    • Crosslink RNA-protein complexes in vivo

    • Immunoprecipitate FTSJ2-bound RNAs

    • Identify binding sites through high-throughput sequencing

How do researchers reconcile contradictory findings regarding FTSJ2's role in cancer?

There are conflicting reports regarding FTSJ2's role in cancer. While FTSJ2 locus in the genome, gene amplification, and mRNA overexpression were discovered in several non-small cell lung cancer (NSCLC) tissue samples , functional studies suggest FTSJ2 may have tumor-suppressive properties, inhibiting cell invasion and migration .

Methodological approach to resolve contradictions:

  • Comprehensive expression analysis:

    • Analyze FTSJ2 expression across cancer stages (early, advanced, metastatic)

    • Compare expression in matched normal-tumor pairs

    • Correlate expression with clinical outcomes

  • Functional validation in multiple models:

    • Test effects of both overexpression and knockdown in diverse cell lines

    • Use both in vitro and in vivo models to validate findings

    • Investigate context-dependent effects (cell type, genetic background)

  • Mechanistic studies:

    • Identify downstream pathways affected by FTSJ2 modulation

    • Investigate interaction partners through co-immunoprecipitation and mass spectrometry

    • Explore potential post-translational modifications that might alter function

  • Clinical correlation:

    • Analyze large-scale cancer genomics datasets (TCGA, ICGC)

    • Perform multivariate analysis to account for confounding factors

    • Consider genetic alterations versus expression changes

Product Science Overview

Structure and Expression

FTSJ2 is a nucleolar protein that plays a crucial role in the processing and modification of ribosomal RNA (rRNA). It is involved in the formation of 2’-O-methyluridine at position 1369 (Um1369) in the 16S mitochondrial large subunit ribosomal RNA (mtLSU rRNA), a universally conserved modification in the peptidyl transferase domain of the mtLSU rRNA . The protein is extensively expressed in various tissues, with the highest expression levels observed in the muscle, placenta, and heart .

Functional Role

FTSJ2 is implicated in several cellular processes, including:

  • Cell Cycle Control: It is involved in the regulation of the cell cycle, ensuring proper cell division and proliferation .
  • DNA Repair: FTSJ2 plays a role in the DNA repair mechanisms, maintaining genomic stability and integrity .
  • rRNA Processing: The protein is essential for the processing and modification of rRNA, which is critical for the proper functioning of ribosomes and protein synthesis .
Recombinant FTSJ2

Recombinant human FTSJ2 is produced using Escherichia coli expression systems. The recombinant protein typically includes an N-terminal His-tag for purification purposes and is used in various research applications, including SDS-PAGE and mass spectrometry (MS) . The recombinant form of FTSJ2 is highly purified, with a purity level exceeding 95% .

Applications in Research

Recombinant FTSJ2 is widely used in scientific research to study its function and role in cellular processes. It is also utilized in the development of assays and experiments aimed at understanding the mechanisms of rRNA modification and the impact of these modifications on cellular physiology .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.